Cart 26 Product Products 3 195,12 € (empty)
-
1 x GRIK2-glut...121,50 € -
1 x NME4-non-m...113,40 € -
1 x ISCU-iron-...113,40 € -
1 x POM121L1-P...121,50 € -
-
1 x SCAMP2-sec...121,50 € -
1 x SFRS6-spli...121,50 € -
-
1 x FAM113B-fa...121,50 € -
1 x PDE6G-phos...113,40 € -
-
1 x PPIL4-pept...113,40 € -
1 x S100A14-S1...113,40 € -
1 x SURF4-surf...121,50 € -
-
-
-
1 x UBE2Q1-ubi...113,40 € -
1 x FBXO9-F-bo...121,50 € -
-
-
1 x Peroxin 2...259,07 € -
1 x eIF1AY...259,07 € -
-
-
No products
To be determined Shipping
3 195,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 195,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 195,12 €
Data sheet of ZNF593-zinc finger protein 593 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF593-zinc finger protein 593 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002580 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF593 |
| Origin species: | Human |
| Product name: | ZNF593-zinc finger protein 593 Gene |
| Size: | 2ug |
| Accessions: | BC002580 |
| Gene id: | 51042 |
| Gene description: | zinc finger protein 593 |
| Synonyms: | ZT86; zinc finger protein 593; zinc finger protein T86 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggcgaagcggcggcggccggacttggatgagattcaccgcgagctgcggcctcagggatccgcacgaccccagcccgacccaaacgccgagttcgaccccgacctgccagggggcggtctgcaccgctgtctggcctgcgcgaggtacttcatcgattccaccaacctgaagacccacttccgatccaaagaccacaagaaaaggctgaagcagctgagcgtcgagccctacagtcaggaagaggcggagagggcagcgggtatgggatcctatgtgccccccaggcggctggcagtgcccacggaagtgtccactgaggtccctgagatggatacctctacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NTF2-like export factor 1 - zinc finger protein 611 - zinc finger protein 580 - zinc finger protein 747 |