RNF220-ring finger protein 220 Gene

View larger

RNF220-ring finger protein 220 Gene

Reference: PTXBC000279

Condition: New product

Print

Data sheet of RNF220-ring finger protein 220 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RNF220-ring finger protein 220 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC000279
Product type:	DNA & cDNA
Ncbi symbol:	RNF220
Origin species:	Human
Product name:	RNF220-ring finger protein 220 Gene
Size:	2ug
Accessions:	BC000279
Gene id:	55182
Gene description:	ring finger protein 220
Synonyms:	E3 ubiquitin-protein ligase RNF220; C1orf164; ring finger protein 220
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtttacaatgttgtgtataaatgggacaactcctcgccctctacctgtcccctccccctttggttgtatgattttcttcttttttaagaacccctggaagcagtgcctccttcagggttggctgggagctcggcccatccacctcttggggtatctgcctctctctctcctgtggtgtcccttccctctcccatgtgctcggtgttcagtggtgtatatttcttctcccagacatggggcacacgccccaagggacatgatcctctccttagtcttagctcatggggctctttataaggagttggggggtagaggcaggaaatgggaaccgagctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- zinc finger protein 593 - NTF2-like export factor 1 - zinc finger protein 611 - zinc finger protein 580

Reviews

Be the first to write your review !

Buy RNF220-ring finger protein 220 Gene now