Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RBX1-ring-box 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBX1-ring-box 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001466 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBX1 |
| Origin species: | Human |
| Product name: | RBX1-ring-box 1 Gene |
| Size: | 2ug |
| Accessions: | BC001466 |
| Gene id: | 9978 |
| Gene description: | ring-box 1 |
| Synonyms: | E3 ubiquitin-protein ligase RBX1; BA554C12.1; RNF75; ROC1; RING finger protein 75; RING-box protein 1; ZYP protein; regulator of cullins 1; ring-box 1, E3 ubiquitin protein ligase; ring-box 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcagcgatggatgtggataccccgagcggcaccaacagcggcgcgggcaagaagcgctttgaagtgaaaaagtggaatgcagtagccctctgggcctgggatattgtggttgataactgtgccatctgcaggaaccacattatggatctttgcatagaatgtcaagctaaccaggcgtccgctacttcagaagagtgtactgtcgcatggggagtctgtaaccatgcttttcacttccactgcatctctcgctggctcaaaacacgacaggtgtgtccattggacaacagagagtgggaattccaaaagtatgggcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adipogenin - profilin 1 - ubiquitin D - GSG1-like |