> >>FKBP1A-FK506 binding protein 1A, 12kDa Gene
FKBP1A-FK506 binding protein 1A, 12kDa Gene View larger

FKBP1A-FK506 binding protein 1A, 12kDa Gene

PTXBC005147

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FKBP1A-FK506 binding protein 1A, 12kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP1A-FK506 binding protein 1A, 12kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005147
Product type: DNA & cDNA
Ncbi symbol: FKBP1A
Origin species: Human
Product name: FKBP1A-FK506 binding protein 1A, 12kDa Gene
Size: 2ug
Accessions: BC005147
Gene id: 2280
Gene description: FK506 binding protein 1A, 12kDa
Synonyms: PPIase FKBP1A; peptidyl-prolyl cis-trans isomerase FKBP1A; FKBP-12; FKBP-1A; FKBP1; PKC12; PKCI2; PPIASE; 12 kDa FK506-binding protein; 12 kDa FKBP; FK506 binding protein 1A, 12kDa; FK506 binding protein12; FK506-binding protein 1; FK506-binding protein 12; FK506-binding protein, T-cell, 12-kD; FKBP12-Exip3; calstabin-1; immunophilin FKBP12; protein kinase C inhibitor 2; rotamase; FK506 binding protein 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaagaaatttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinal G protein coupled receptor
- ribonuclease P/MRP 14kDa subunit
- cAMP responsive element modulator
- cornichon homolog 4 (Drosophila)

Reviews

Buy FKBP1A-FK506 binding protein 1A, 12kDa Gene now

Add to cart