Cart 11 Product Products 1 256,04 € (empty)
-
1 x GRIK2-glut...121,50 € -
1 x NME4-non-m...113,40 € -
1 x ISCU-iron-...113,40 € -
1 x POM121L1-P...121,50 € -
-
1 x SCAMP2-sec...121,50 € -
1 x SFRS6-spli...121,50 € -
-
1 x FAM113B-fa...121,50 € -
1 x PDE6G-phos...113,40 € -
No products
To be determined Shipping
1 256,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 256,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 256,04 €
View larger 
Data sheet of DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034713 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC10 |
| Origin species: | Human |
| Product name: | DNAJC10-DnaJ (Hsp40) homolog, subfamily C, member 10 Gene |
| Size: | 2ug |
| Accessions: | BC034713 |
| Gene id: | 54431 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 10 |
| Synonyms: | ERdj5; JPDI; MTHr; PDIA19; dnaJ homolog subfamily C member 10; DnaJ (Hsp40) homolog, subfamily C, member 10; ER-resident protein ERdj5; J-domain-containing protein disulfide isomerase-like protein; endoplasmic reticulum DNA J domain-containing protein 5; macrothioredoxin; protein disulfide isomerase family A, member 19; DnaJ heat shock protein family (Hsp40) member C10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattaaaggaaaagtgaaagctggaaaagtagactgtcaggcttatgctcagacatgccagaaagctgggatcagggcctatccaactgttaagttttatttctacgaaagagcaaagagaaattttcaagaagagcagataaataccagagatgcaaaagcaatcgctgccttaataagtgaaaaattggaaactctccgaaatcaaggcaagaggaataaggatgaactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD79b molecule, immunoglobulin-associated beta - trafficking protein particle complex 2-like - fucosyltransferase 2 (secretor status included) - DnaJ (Hsp40) homolog, subfamily C, member 12 |