> >>PRKCH-protein kinase C, eta Gene
PRKCH-protein kinase C, eta Gene View larger

PRKCH-protein kinase C, eta Gene

PTXBC001000

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PRKCH-protein kinase C, eta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRKCH-protein kinase C, eta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001000
Product type: DNA & cDNA
Ncbi symbol: PRKCH
Origin species: Human
Product name: PRKCH-protein kinase C, eta Gene
Size: 2ug
Accessions: BC001000
Gene id: 5583
Gene description: protein kinase C, eta
Synonyms: PKC-L; PKCL; PRKCL; nPKC-eta; protein kinase C eta type; protein kinase C eta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcactagaaatagttgataatgaaatgagattttatgaagtataccgctccacctatgagcgtctgtctctgtgggcttgggatgttaacaggagccaaaaggagggaaagtgtgaagaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L34
- CD99 molecule-like 2
- ribosomal protein S19
- MYC associated factor X

Reviews

Buy PRKCH-protein kinase C, eta Gene now

Add to cart