Cart 41 Product Products 6 786,71 € (empty)
-
1 x SERPINA4-s...121,50 € -
-
1 x BRUNOL5-br...121,50 € -
1 x SERPINA10-...121,50 € -
1 x PMEPA1-pro...113,40 € -
1 x Phospho-HS...259,07 € -
-
-
1 x RNF7-ring...113,40 € -
1 x HBA1-hemog...113,40 € -
1 x PSG1-pregn...121,50 € -
1 x SERP1-stre...113,40 € -
-
-
1 x SERPINA3-s...121,50 € -
1 x OR2C1-olfa...121,50 € -
1 x HHAT-hedge...121,50 € -
-
1 x GCLM-gluta...121,50 € -
-
-
-
-
-
1 x CCDC108-co...113,40 € -
1 x GORASP2-go...121,50 € -
1 x SERPINB12-...121,50 € -
-
-
1 x OGG1-8-oxo...121,50 € -
1 x SERPINI2-s...121,50 € -
1 x ANGPTL4-an...121,50 € -
1 x sVCAM-1494,00 € -
-
1 x HAT1-histo...113,40 € -
1 x KRT8-kerat...121,50 € -
1 x APOBEC3G-a...113,40 € -
-
-
-
1 x IFI44-inte...121,50 € -
No products
To be determined Shipping
6 786,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 41 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 786,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 786,71 €
View larger 
Data sheet of ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC002466 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARAF |
| Origin species: | Human |
| Product name: | ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene |
| Size: | 2ug |
| Accessions: | BC002466 |
| Gene id: | 369 |
| Gene description: | v-raf murine sarcoma 3611 viral oncogene homolog |
| Synonyms: | A-RAF; ARAF1; PKS2; RAFA1; serine/threonine-protein kinase A-Raf; A-Raf proto-oncogene serine/threonine-protein kinase; Oncogene ARAF1; Ras-binding protein DA-Raf; proto-oncogene A-Raf-1; proto-oncogene Pks; v-raf murine sarcoma 3611 viral oncogene homolog 1; v-raf murine sarcoma 3611 viral oncogene-like protein; A-Raf proto-oncogene, serine/threonine kinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccaccacggggcccccctgccaatggggccgagccatcccgggcagtgggcaccgtcaaagtatacctgcccaacaagcaacgcacggtggtgactgtccgggatggcatgagtgtctacgactctctagacaaggccctgaaggtgcggggtctaaatcaggactgctgtgtggtctaccgactcatcaagggacgaaagacggtcactgcctgggacacagccattgctcccctggatggcgaggagctcattgtcgaggtccttgaagatgtcccgctgaccatgcacaattttgtacggaagaccttcttcagcctggcgttctgtgacttctgccttaagtttctgttccatggcttccgttgccaaacctgtggctacaagttccaccagcattgttcctccaaggtccccacagtctgtgttgacatgagtaccaaccgccaacagttctaccacagtgtccaggatttgtccggaggctccagacagcatgaggctccctcgaaccgccccctgaatgagttgctaaccccccagggtcccagcccccgcacccagcactgtgacccggagcacttccccttccctgccccagccaatgcccccctacagcgcatccgctccacgtccactcccaacgtccatatggtcagcaccacggcccccatggactccaacctcatccagctcactggccagagtttcagcactgatgctgccggtagtagaggaggtagtgatggaaccccccgggggagccccagcccagccagcgtgtcctcggggaggaagtccccacattccaagtcaccagcagagcagcgcgagcggaagtccttggccgatgacaagaagaaagtgaagaacctggggtaccgggactcaggctattactgggaggtaccacccagtgaggtgcagctgctgaagaggatcgggacgggctcgtttggcaccgtgtttcgagggcggtggcatggcgatgtggccgtgaaggtgctcaaggtgtcccagcccacagctgagcaggcccaggctttcaagaatgagatgcaggtgctcaggaagacgcgacatgtcaacatcttgctgtttatgggcttcatgacccggccgggatttgccatcatcacacagtggtgtgagggctccagcctctaccatcacctgcatgtggccgacacacgcttcgacatggtccagctcatcgacgtggcccggcagactgcccagggcatggactacctccatgccaagaacatcatccaccgagatctcaagtctaacaacatcttcctacatgaggggctcacggtgaagatcggtgactttggcttggccacagtgaagactcgatggagcggggcccagcccttggagcagccctcaggatctgtgctgtggatggcagctgaggtgatccgtatgcaggacccgaacccctacagcttccagtcagacgtctatgcctacggggttgtgctctacgagcttatgactggctcactgccttacagccacattggctgccgtgaccagattatctttatggtgggccgtggctatctgtccccggacctcagcaaaatctccagcaactgccccaaggccatgcggcgcctgctgtctgactgcctcaagttccagcgggaggagcggcccctcttcccccagatcctggccacaattgagctgctgcaacggtcactccccaagattgagcggagtgcctcggaaccctccttgcaccgcacccaggccgatgagttgcctgcctgcctactcagcgcagcccgccttgtgccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG7 autophagy related 7 homolog (S. cerevisiae) - transforming growth factor, beta-induced, 68kDa - echinoderm microtubule associated protein like 1 - 3-hydroxy-3-methylglutaryl-Coenzyme A reductase |