Cart 12 Product Products 1 382,58 € (empty)
-
1 x C15orf5-ch...113,40 € -
1 x C5orf45-ch...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x ATP5L-ATP...113,40 € -
1 x HNRPDL-het...121,50 € -
-
1 x C19orf36-c...113,40 € -
1 x MED27-medi...113,40 € -
1 x NOSTRIN-ni...121,50 € -
1 x FAM102A-fa...113,40 € -
1 x TIGIT-T...113,40 € -
1 x ADAM18-ADA...113,40 €
No products
To be determined Shipping
1 382,58 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 382,58 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 382,58 €
Data sheet of NRBP1-nuclear receptor binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NRBP1-nuclear receptor binding protein 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC001221 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NRBP1 |
| Origin species: | Human |
| Product name: | NRBP1-nuclear receptor binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC001221 |
| Gene id: | 29959 |
| Gene description: | nuclear receptor binding protein 1 |
| Synonyms: | BCON3; MADM; MUDPNP; nuclear receptor-binding protein; multiple domain putative nuclear protein; myeloid leukemia factor 1 adaptor molecule; nuclear receptor binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggagggggagtcccagacagtacttagcagtggctcagacccaaaggtagaatcctcatcttcagctcctggcctgacatcagtgtcacctcctgtgacctccacaacctcagctgcttccccagaggaagaagaagaaagtgaagatgagtctgagattttggaagagtcgccctgtgggcgctggcagaagaggcgagaagaggtgaatcaacggaatgtaccaggtattgacagtgcatacctggccatggatacagaggaaggtgtagaggttgtgtggaatgaggtacagttctctgaacgcaagaactacaagctgcaggaggaaaaggttcgtgctgtgtttgataatctgattcaattggagcatcttaacattgttaagtttcacaaatattgggctgacattaaagagaacaaggccagggtcatttttatcacagaatacatgtcatctgggagtctgaagcaatttctgaagaagaccaaaaagaaccacaagacgatgaatgaaaaggcatggaagcgttggtgcacacaaatcctctctgccctaagctacctgcactcctgtgacccccccatcatccatgggaacctgacctgtgacaccatcttcatccagcacaacggactcatcaagattggctctgtggctcctgacactatcaacaatcatgtgaagacttgtcgagaagagcagaagaatctacacttctttgcaccagagtatggagaagtcactaatgtgacaacagcagtggacatctactcctttggcatgtgtgcactggagatggcagtgctggagattcagggcaatggagagtcctcatatgtgccacaggaagccatcagcagtgccatccagcttctagaagacccattacagagggagttcattcaaaagtgcctgcagtctgagcctgctcgcagaccaacagccagagaacttctgttccacccagcattgtttgaagtgccctcgctcaaactccttgcggcccactgcattgtgggacaccaacacatgatcccagagaacgctctagaggagatcaccaaaaacatggatactagtgccgtactggctgaaatccctgcaggaccaggaagagaaccagttcagactttgtactctcagtcaccagctctggaattagataaattccttgaagatgtcaggaatgggatctatcctctgacagcctttgggctgcctcggccccagcagccacagcaggaggaggtgacatcacctgtcgtgcccccctctgtcaagactccgacacctgaaccagctgaggtggagactcgcaaggtggtgctgatgcagtgcaacattgagtcggtggaggagggagtcaaacaccacctgacacttctgctgaagttggaggacaaactgaaccggcacctgagctgtgacctgatgccaaatgagaatatccccgagttggcggctgagctggtgcagctgggcttcattagtgaggctgaccagagccggttgacttctctgctagaagagaccttgaacaagttcaattttgccaggaacagtaccctcaactcagccgctgtcaccgtctcctcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetratricopeptide repeat domain 12 - tetratricopeptide repeat domain 14 - heat shock 105kDa/110kDa protein 1 - tetratricopeptide repeat domain 16 |