Cart 6 Product Products 712,80 € (empty)
-
1 x USH1G-Ushe...121,50 € -
1 x H3F3A-H3...113,40 € -
1 x SNX15-sort...121,50 € -
1 x PPP1R8-pro...113,40 € -
1 x LASS4-LAG1...121,50 € -
1 x SMAD9-SMAD...121,50 €
No products
To be determined Shipping
712,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 712,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 712,80 €
View larger 
Data sheet of SLC22A18-solute carrier family 22, member 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A18-solute carrier family 22, member 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A18 |
| Origin species: | Human |
| Product name: | SLC22A18-solute carrier family 22, member 18 Gene |
| Size: | 2ug |
| Accessions: | BC015571 |
| Gene id: | 5002 |
| Gene description: | solute carrier family 22, member 18 |
| Synonyms: | BWR1A; BWSCR1A; HET; IMPT1; ITM; ORCTL2; SLC22A1L; TSSC5; p45-BWR1A; solute carrier family 22 member 18; beckwith-Wiedemann syndrome chromosomal region 1 candidate gene A protein; efflux transporter-like protein; imprinted multi-membrane-spanning polyspecific transporter-related protein 1; organic cation transporter-like protein 2; p45 Beckwith-Wiedemann region 1A; tumor-suppressing STF cDNA 5 protein; tumor-suppressing subchromosomal transferable fragment candidate gene 5 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagggagctcgggctcccagggaccagggccagtcccccggcaggatgagcgctctaggccggtcctcggtcatcttgcttacctacgtgctggccgccacagaacttacctgcctcttcatgcagttctccatcgtgccatacctgtctcggaaactgggcctggattccattgccttcggctacctgcaaaccaccttcggggtgctgcagctgctgggcgggccggtgtttggcaggttcgcagaccagcgcggggcgcgggcggcgctcacgctctccttcctggctgccttggcgctctacctgctcctggcggccgcctccagcccggccctgcccggggtctacctgctcttcgcctcgcgcctgcccggagcgctcatgcacacgctgccagccgcccagatggtcatcacggacctgtcggcacccgaggagcggcccgcggccctgggccggctgggcctctgcttcggcgtcggagtcatcctcggctccctgctgggcgggaccctggtctccgcgtacgggattcagtgcccggccatcctggctgccctggccaccctcctgggagctgtcctcagcttcacctgcatccccgccagcaccaaaggggccaaaactgacgcccaggctccactgccaggcggcccccgggccagtgtgttcgacctgaaggccatcgcctccctgctgcggctgccagacgtcccgaggatcttcctggtgaaggtggcctccaactgccccacagggctcttcatggtcatgttctccatcatctccatggacttcttccagctggaggccgcccaagctggctacctcatgtccttcttcgggctcctccagatggtgacccagggcctggtcatcgggcagctgagcagccacttctcggaggaggtgctgctccgggccagcgtgctggtcttcatcgtggtgggcctggccatggcctggatgtccagcgtcttccacttctgcctcctggtgcccggcctggtgttcagcctctgcaccctcaacgtggtcaccgacagcatgctgatcaaggctgtctccacctcggacacagggaccatgctgggcctctgcgcctctgtacaaccactgctccgaactctgggacccacggtcggcggcctcctgtaccgcagctttggcgtccccgtcttcggccacgtgcaggttgctatcaatacccttgtcctcctggtcctctggaggaaacctatgccccagaggaaggacaaagtccggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger CCCH-type containing 12A - chromosome 1 open reading frame 116 - chromosome 17 open reading frame 80 - protein inhibitor of activated STAT, 3 |