Cart 6 Product Products 2 772,78 € (empty)
-
1 x TNF-beta494,00 € -
1 x Trefoil...644,00 € -
1 x Testosterone544,00 € -
-
1 x TIMP-1494,00 € -
1 x TNF-alpha...494,00 €
No products
To be determined Shipping
2 772,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 772,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 772,78 €
View larger 
SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene
PTXBC015663
New product
Data sheet of SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINE2 |
| Origin species: | Human |
| Product name: | SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC015663 |
| Gene id: | 5270 |
| Gene description: | serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 |
| Synonyms: | GDN; GDNPF; PI-7; PI7; PN-1; PN1; PNI; glia-derived nexin; glial-derived neurite promoting factor; peptidase inhibitor 7; protease nexin I; serpin E2; serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2; serpin family E member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcccacttcaatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaatcagattgtgaagtcgaggcctcatgacaacatcgtgatctctccccatgggattgcgtcggtcctggggatgcttcagctgggggcggacggcaggaccaagaagcagctcgccatggtgatgagatacggcgtaaatggagttggtaaaatattaaagaagatcaacaaggccatcgtctccaagaagaataaagacattgtgacagtggctaacgccgtgtttgttaagaatgcctctgaaattgaagtgccttttgttacaaggaacaaagatgtgttccagtgtgaggtccggaatgtgaactttgaggatccagcctctgcctgtgattccatcaatgcatgggttaaaaatgaaaccagggatatgattgacaatctgctgtccccagatcttattgatggtgtgctcaccagactggtcctcgtcaacgcagtgtatttcaagggtctgtggaaatcacggttccaacccgagaacacaaagaaacgcactttcgtggcagccgacgggaaatcctatcaagtgccaatgctggcccagctctccgtgttccggtgtgggtcgacaagtgcccccaatgatttatggtacaacttcattgaactgccctaccacggggaaagcatcagcatgctgattgcactgccgactgagagctccactccgctgtctgccatcatcccacacatcagcaccaagaccatagacagctggatgagcatcatggtgcccaagagggtgcaggtgatcctgcccaagttcacagctgtagcacaaacagatttgaaggagccgctgaaagttcttggcattactgacatgtttgattcatcaaaggcaaattttgcaaaaataacaacagggtcagaaaacctccatgtttctcatatcttgcaaaaagcaaaaattgaagtcagtgaagatggaaccaaagcttcagcagcaacaactgcaattctcattgcaagatcatcgcctccctggtttatagtagacagaccttttctgtttttcatccgacataatcctacaggtgctgtgttattcatggggcagataaacaaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) - nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein - homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 - homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 |