Cart 50 Product Products 7 532,54 € (empty)
-
1 x FLJ20628-h...121,50 € -
1 x Centriolin...259,07 € -
1 x ARHGAP15-R...121,50 € -
1 x PCLO-picco...113,40 € -
1 x KIAA0040-K...113,40 € -
1 x ARHGEF18-r...113,40 € -
1 x BTLA-B and...113,40 € -
1 x RIN1...259,07 € -
1 x NR5A2-nucl...121,50 € -
1 x CTSZ-cathe...121,50 € -
-
1 x Decorin544,00 € -
1 x SFXN3-side...121,50 € -
1 x CRLF3-cyto...121,50 € -
1 x AKAP7-A...113,40 € -
1 x MEIS2-Meis...121,50 € -
-
1 x FXN-fratax...113,40 € -
1 x ARHGAP1...259,07 € -
1 x ARHGAP12...259,07 € -
1 x DEGS1-dege...121,50 € -
1 x BTN3A2-but...121,50 € -
-
-
-
1 x MRFAP1L1-M...113,40 € -
1 x HSD17B6-hy...121,50 € -
1 x GLYATL1-gl...121,50 € -
-
-
1 x Cu/ZnSOD494,00 € -
1 x Cytochrome c494,00 € -
1 x CA4-carbon...121,50 € -
1 x ESSPL-epid...121,50 € -
1 x ZNF253-zin...121,50 € -
1 x SRD5A2-ste...113,40 € -
1 x FCAR-Fc...121,50 € -
1 x UBE2I-ubiq...113,40 € -
1 x TMEM19-tra...121,50 € -
1 x PNOC-prepr...113,40 € -
1 x BSG-basigi...121,50 € -
1 x DPF2-D4,...121,50 € -
1 x MFAP3-micr...121,50 € -
1 x RPL23-ribo...113,40 € -
-
1 x BTN2A2-but...121,50 € -
1 x NUSAP1-nuc...121,50 € -
1 x VAPA-VAMP...113,40 € -
-
No products
To be determined Shipping
7 532,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 50 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 532,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 532,54 €
View larger 
ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
PTXBC016828
New product
Data sheet of ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016828 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASAH1 |
| Origin species: | Human |
| Product name: | ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene |
| Size: | 2ug |
| Accessions: | BC016828 |
| Gene id: | 427 |
| Gene description: | N-acylsphingosine amidohydrolase (acid ceramidase) 1 |
| Synonyms: | ACDase; ASAH; PHP; PHP32; SMAPME; acid ceramidase; N-acylsphingosine amidohydrolase (acid ceramidase) 1; acid CDase; acylsphingosine deacylase; N-acylsphingosine amidohydrolase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactgctgcatcgggctgggagagaaggctcgcgggtcccaccgggcctcctacccaagtctcagcgcgcttttcaccgaggcctcaattctgggatttggcagctttgctgtgaaagcccaatggacagaggactgcagaaaatcaacctatcctccttcaggaccaactgtcttccctgctgttataaggtacagaggtgcagttccatggtacaccataaatcttgacttaccaccctacaaaagatggcatgaattgatgcttgacaaggcaccagtgcctggcctacttggcaactttcctggcccttttgaagaggaaatgaagggtattgccgctgttactgatatacctttaggagagattatttcattcaatattttttatgaattatttaccgtttgtacttcaatagtagcagaagacaaaaaaggtcatctaatacatgggagaaacatggattttggagtatttcttgggtggaacataaataatgatacctgggtcataactgagcaactaaaacctttaacagtgaatttggatttccaaagaaacaacaaaactgtcttcaaggcttcaagctttgctggctatgtgggcatgttaacaggattcaaaccaggactgttcagtcttacactgaatgaacgtttcagtataaatggtggttatctgggtattctagaatggattctgggaaagaaagatgccatgtggatagggttcctcactagaacagttctggaaaatagcacaagttatgaagaagccaagaatttattgaccaagaccaagatattggccccagcctactttatcctgggaggcaaccagtctggggaaggttgtgtgattacacgagacagaaaggaatcattggatgtatatgaactcgatgctaagcagggtagatggtatgtggtacaaacaaattatgaccgttggaaacatcccttcttccttgatgatcgcagaacgcctgcaaagatgtgtttgaaccgcaccagccaagagaatatctcatttgaaaccatgtatgatgtcctgtcaacaaaacctgtcctcaacaagctgaccgtatacacaaccttgatagatgttaccaaaggtcaattcgaaacttacctgcgggactgccctgacccttgtataggttggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein-like 3 (nucleolar) - ATP-binding cassette, sub-family F (GCN20), member 2 - ral guanine nucleotide dissociation stimulator-like 2 - signal transducer and activator of transcription 5A |