Cart 23 Product Products 2 713,72 € (empty)
-
-
1 x MRPL20-mit...113,40 € -
1 x HIST1H4J-h...113,40 € -
1 x KLC3-kines...113,40 € -
1 x C17orf54-c...113,40 € -
1 x ERAF-eryth...113,40 € -
-
1 x PMPCB-pept...121,50 € -
1 x COMT-catec...113,40 € -
-
1 x MGC15634-h...113,40 € -
1 x HIST2H4B-h...113,40 € -
1 x SNRNP35-sm...113,40 € -
1 x C8orf74-ch...121,50 € -
1 x TAF8-TAF8...113,40 € -
1 x GSTO2-glut...113,40 € -
-
1 x FBXW4-F-bo...121,50 € -
1 x KLF3-Krupp...121,50 € -
1 x CXorf40B-c...113,40 € -
-
1 x RAB37-RAB3...113,40 € -
No products
To be determined Shipping
2 713,72 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 713,72 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 713,72 €
View larger 
Data sheet of DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene
| Proteogenix catalog: | PTXBC012115 |
| Ncbi symbol: | DNAJB5 |
| Product name: | DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC012115 |
| Gene id: | 25822 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 5 |
| Synonyms: | dnaJ homolog subfamily B member 5; DnaJ (Hsp40) homolog, subfamily B, member 5; heat shock cognate 40; heat shock protein Hsp40-2; heat shock protein Hsp40-3; heat shock protein cognate 40; DnaJ heat shock protein family (Hsp40) member B5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaaagattattacaagattcttgggatcccatcgggggccaacgaggatgagatcaagaaagcctaccggaagatggccttgaagtaccacccagacaagaataaagaacccaacgctgaggagaagtttaaggagattgcagaggcctatgatgtgctaagtgaccccaagaaacggggcctgtatgaccagtatggggaggaaggcctgaagaccggcggtggcacatcaggtggctccagtggctcctttcactacacctttcatggggacccccatgccacctttgcctccttctttggtggctccaaccccttcgatatcttctttgccagcagccgctccactcggcccttcagtggctttgacccagatgacatggatgtggatgaagatgaggacccatttggcgctttcggccgttttggcttcaatgggctgagtaggggtccaaggcgagccccagaaccactgtaccctcggcgcaaggtgcaggaccccccagtggtgcacgagctgcgggtgtccctggaggagatctaccatggctccaccaagcgcatgaagatcacaaggcgtcgcctcaaccctgatgggcgaactgtgcgcaccgaggacaagatcctgcacatagtcatcaagcgtggctggaaggaaggcaccaagatcaccttccccaaagaaggcgacgccacacctgacaacatccctgctgacatcgtctttgtgctcaaagacaagccccatgcacacttccgccgagatggcaccaacgtgctctacagtgccctgatcagcctcaaggaggcgctgtgtggctgcactgtgaacattcccactatcgacggccgagtgatccctttgccctgcaatgatgtcatcaagccaggcaccgtgaagagactccgtggggagggccttcccttccccaaagtgccaactcagcgaggagacctcattgttgagttcaaagttcgcttcccagacagattaacaccacagacaagacagatccttaagcagcaatacccccaacactcactccactcaatgtgcacccagcttgatgtccactggacactggcaactttttctaaaatgcaaaaaaaagccactggttttcaggaaaatgttcctgtccctgaccccttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |