Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S1PR1-sphingosine-1-phosphate receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S1PR1-sphingosine-1-phosphate receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018650 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S1PR1 |
| Origin species: | Human |
| Product name: | S1PR1-sphingosine-1-phosphate receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC018650 |
| Gene id: | 1901 |
| Gene description: | sphingosine-1-phosphate receptor 1 |
| Synonyms: | CD363; CHEDG1; D1S3362; ECGF1; EDG-1; EDG1; S1P1; sphingosine 1-phosphate receptor 1; S1P receptor 1; S1P receptor Edg-1; endothelial differentiation G-protein coupled receptor 1; endothelial differentiation, sphingolipid G-protein-coupled receptor, 1; sphingosine 1-phosphate receptor EDG1; sphingosine 1-phosphate receptor Edg-1; sphingosine-1-phosphate receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcccaccagcgtcccgctggtcaaggcccaccgcagctcggtctctgactacgtcaactatgatatcatcgtccggcattacaactacacgggaaagctgaatatcagcgcggacaaggagaacagcattaaactgacctcggtggtgttcattctcatctgctgctttatcatcctggagaacatctttgtcttgctgaccatttggaaaaccaagaaattccaccgacccatgtactattttattggcaatctggccctctcagacctgttggcaggagtagcctacacagctaacctgctcttgtctggggccaccacctacaagctcactcccgcccagtggtttctgcgggaagggagtatgtttgtggccctgtcagcctccgtgttcagtctcctcgccatcgccattgagcgctatatcacaatgctgaaaatgaaactccacaacgggagcaataacttccgcctcttcctgctaatcagcgcctgctgggtcatctccctcatcctgggtggcctgcctatcatgggctggaactgcatcagtgcgctgtccagctgctccaccgtgctgccgctctaccacaagcactatatcctcttctgcaccacggtcttcactctgcttctgctctccatcgtcattctgtactgcagaatctactccttggtcaggactcggagccgccgcctgacgttccgcaagaacatttccaaggccagccgcagctctgagaagtcgctggcgctgctcaagaccgtaattatcgtcctgagcgtcttcatcgcctgctgggcaccgctcttcatcctgctcctgctggatgtgggctgcaaggtgaagacctgtgacatcctcttcagagcggagtacttcctggtgttagctgtgctcaactccggcaccaaccccatcatttacactctgaccaacaaggagatgcgtcgggccttcatccggatcatgtcctgctgcaagtgcccgagcggagactctgctggcaaattcaagcgacccatcatcgccggcatggaattcagccgcagcaaatcggacaattcctcccacccccagaaagacgaaggggacaacccagagaccattatgtcttctggaaacgtcaactcttcttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nitric oxide synthase trafficker - mitochondrial ribosomal protein S5 - RELT tumor necrosis factor receptor - farnesyltransferase, CAAX box, beta |