Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene
PTXBC014972
New product
Data sheet of IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014972 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL2RG |
| Origin species: | Human |
| Product name: | IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene |
| Size: | 2ug |
| Accessions: | BC014972 |
| Gene id: | 3561 |
| Gene description: | interleukin 2 receptor, gamma (severe combined immunodeficiency) |
| Synonyms: | CD132; CIDX; IL-2RG; IMD4; P64; SCIDX; SCIDX1; cytokine receptor common subunit gamma; CD132 antigen; IL-2 receptor subunit gamma; IL-2R subunit gamma; common cytokine receptor gamma chain; gammaC; interleukin 2 receptor, gamma; interleukin 2 receptor subunit gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgaagccatcattaccattcacatccctcttattcctgcagctgcccctgctgggagtggggctgaacacgacaattctgacgcccaatgggaatgaagacaccacagctgatttcttcctgaccactatgcccactgactccctcagtgtttccactctgcccctcccagaggttcagtgttttgtgttcaatgtcgagtacatgaattgcacttggaacagcagctctgagccccagcctaccaacctcactctgcattattggtacaagaactcggataatgataaagtccagaagtgcagccactatctattctctgaagaaatcacttctggctgtcagttgcaaaaaaaggagatccacctctaccaaacatttgttgttcagctccaggacccacgggaacccaggagacaggccacacagatgctaaaactgcagaatctggtgatcccctgggctccagagaacctaacacttcacaaactgagtgaatcccagctagaactgaactggaacaacagattcttgaaccactgtttggagcacttggtgcagtaccggactgactgggaccacagctggactgaacaatcagtggattatagacataagttctccttgcctagtgtggatgggcagaaacgctacacgtttcgtgttcggagccgctttaacccactctgtggaagtgctcagcattggagtgaatggagccacccaatccactgggggagcaatacttcaaaagagaatcctttcctgtttgcattggaagccgtggttatctctgttggctccatgggattgattatcagccttctctgtgtgtatttctggctggaacggacgatgccccgaattcccaccctgaagaacctagaggatcttgttactgaataccacgggaacttttcggcctggagtggtgtgtctaagggactggctgagagtctgcagccagactacagtgaacgactctgcctcgtcagtgagattcccccaaaaggaggggcccttggggaggggcctggggcctccccatgcaaccagcatagcccctactgggcccccccatgttacaccctaaagcctgaaacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa - resistance to inhibitors of cholinesterase 3 homolog (C. elegans) - signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 - leucine rich repeat and fibronectin type III domain containing 4 |