Cart 1 Product Products 112,04 € (empty)
No products
To be determined Shipping
112,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 112,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 112,04 €
View larger 
Data sheet of DNAJB6-DnaJ (Hsp40) homolog, subfamily B, member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB6-DnaJ (Hsp40) homolog, subfamily B, member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002446 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB6 |
| Origin species: | Human |
| Product name: | DNAJB6-DnaJ (Hsp40) homolog, subfamily B, member 6 Gene |
| Size: | 2ug |
| Accessions: | BC002446 |
| Gene id: | 10049 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 6 |
| Synonyms: | DJ4; DnaJ; HHDJ1; HSJ-2; HSJ2; LGMD1D; LGMD1E; MRJ; MSJ-1; dnaJ homolog subfamily B member 6; DnaJ (Hsp40) homolog, subfamily B, member 6; DnaJ-like 2 protein; heat shock protein J2; DnaJ heat shock protein family (Hsp40) member B6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggattactatgaagttctaggcgtgcagagacatgcctcacccgaggatattaaaaaggcatatcggaaactggcactgaagtggcatccagataaaaatcctgagaataaagaagaagcagagagaaaattcaagcaagtagcggaggcatatgaagtgctgtcggatgctaagaaacgggacatctatgacaaatatggcaaagaaggattaaatggtggaggaggaggtggaagtcattttgacagtccatttgaatttggcttcacattccgtaacccagatgatgtcttcagggaattttttggtggaagggacccattttcatttgacttctttgaagacccttttgaggacttctttgggaatcgaaggggtccccgaggaagcagaagccgagggacggggtcgtttttctctgcgttcagtggatttccgtcttttggaagtggattttcttcttttgatacaggatttacttcatttgggtcactaggtcacgggggcctcacttcattctcttccacgtcatttggtggtagtggcatgggcaacttcaaatcgatatcaacttcaactaaaatggttaatggcagaaaaatcactacaaagagaattgtcgagaacggtcaagaaagagtagaagttgaagaagatggccagttaaagtccttaacaataaatggtgtggccgacgacgatgccctcgctgaggagcgcatgcggagaggccagaacgccctgccagcccagcctgccggcctccgcccgccgaagccgccccggcctgcctcgctgctgagacacgcgcctcactgtctctctgaggaggagggcgagcaggaccgacctcgggcacccgggccctgggaccccctcgcgtccgcagcaggattgaaagaaggtggcaagaggaagaagcagaagcagagagaggagtcgaagaagaagaagtcgaccaaaggcaatcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 5 - cadherin 6, type 2, K-cadherin (fetal kidney) - cold shock domain containing E1, RNA-binding - USO1 homolog, vesicle docking protein (yeast) |