Cart 8 Product Products 923,40 € (empty)
-
1 x C12orf45-c...113,40 € -
1 x OPRS1-opio...113,40 € -
1 x C9orf16-ch...113,40 € -
1 x CDCA5-cell...113,40 € -
1 x PIM2-pim-2...121,50 € -
1 x C5orf46-ch...113,40 € -
1 x MBD5-methy...113,40 € -
1 x STX12-synt...121,50 €
No products
To be determined Shipping
923,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 923,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 923,40 €
View larger 
Data sheet of SLC25A33-solute carrier family 25, member 33 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A33-solute carrier family 25, member 33 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A33 |
| Origin species: | Human |
| Product name: | SLC25A33-solute carrier family 25, member 33 Gene |
| Size: | 2ug |
| Accessions: | BC004991 |
| Gene id: | 84275 |
| Gene description: | solute carrier family 25, member 33 |
| Synonyms: | BMSC-MCP; PNC1; solute carrier family 25 member 33; PNC1 protein; bone marrow stromal cell mitochondrial carrier protein; huBMSC-MCP; mitochondrial carrier protein; novel mitochondrial carrier protein; solute carrier family 25 (pyrimidine nucleotide carrier), member 33 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgacgggcggccagcagaaggagaacacgctgcttcacctcttcgccggcgggtgtggaggcacagttggtgctattttcacttgtccactagaagtcattaagacacggttgcagtcttcaagattagctctccggacagtctactatcctcaggttcatctggggaccattagtggagctggaatggtgagaccaacatccgtgacacctggactctttcaggttctgaagtcgatcttggagaaagagggaccaaagtcactttttagaggcttgggtccaaatttggttggagttgcaccatcaagggctgtatactttgcatgttactccaaagccaaagagcaatttaatggcattttcgtgcctaacagcaatattgtgcatattttctcagctggctctgcagcttttatcacaaattccttaatgaatcctatatggatggttaaaacccgaatgcagctagaacagaaagtgaggggctctaagcagatgaatacactccagtgtgctcgttacgtttaccagaccgaaggcattcgtggcttctatagaggattaactgcctcgtatgctggaatttccgaaactataatctgctttgctatttatgaaagtttaaagaagtatctgaaagaagctccattagcctcttctgcaaatgggactgagaaaaattccacaagtttttttggacttatggcagctgctgctctttctaagggctgtgcctcctgcattgcttatccacacgaagtcataaggacgaggctccgggaagagggcaccaagtacaagtcttttgtccagacggcgcgcctggtgttccgggaagaaggctaccttgccttttatagaggactgtttgcccagcttatccggcagatcccaaatactgccattgtgttgtctacttatgagttaattgtgtacctgttagaagaccgtactcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22, member 18 - zinc finger CCCH-type containing 12A - chromosome 1 open reading frame 116 - chromosome 17 open reading frame 80 |