Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2CA-protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Gene
PTXBC002657
New product
Data sheet of PPP2CA-protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2CA-protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002657 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2CA |
| Origin species: | Human |
| Product name: | PPP2CA-protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Gene |
| Size: | 2ug |
| Accessions: | BC002657 |
| Gene id: | 5515 |
| Gene description: | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform |
| Synonyms: | PP2CA; PP2Calpha; RP-C; serine/threonine-protein phosphatase 2A catalytic subunit alpha isoform; PP2A-alpha; protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform; protein phosphatase 2, catalytic subunit, alpha isozyme; replication protein C; serine/threonine protein phosphatase 2A, catalytic subunit, alpha isoform; protein phosphatase 2 catalytic subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgagaaggtgttcaccaaggagctggaccagtggatcgagcagctgaacgagtgcaagcagctgtccgagtcccaggtcaagagcctctgcgagaaggctaaagaaatcctgacaaaagaatccaacgtgcaagaggttcgatgtccagttactgtctgtggagatgtgcatgggcaatttcatgatctcatggaactgtttagaattggtggcaaatcaccagatacaaattacttgtttatgggagattatgttgacagaggatattattcagttgaaacagttacactgcttgtagctcttaaggttcgttaccgtgaacgcatcaccattcttcgagggaatcatgagagcagacagatcacacaagtttatggtttctatgatgaatgtttaagaaaatatggaaatgcaaatgtttggaaatattttacagatctttttgactatcttcctctcactgccttggtggatgggcagatcttctgtctacatggtggtctctcgccatctatagatacactggatcatatcagagcacttgatcgcctacaagaagttccccatgagggtccaatgtgtgacttgctgtggtcagatccagatgaccgtggtggttggggtatatctcctcgaggagctggttacacctttgggcaagatatttctgagacatttaatcatgccaatggcctcacgttggtgtctagagctcaccagctagtgatggagggatataactggtgccatgaccggaatgtagtaacgattttcagtgctccaaactattgttatcgttgtggtaaccaagctgcaatcatggaacttgacgatactctaaaatactctttcttgcagtttgacccagcacctcgtagaggcgagccacatgttactcgtcgtaccccagactacttcctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) - hyperpolarization activated cyclic nucleotide-gated potassium channel 3 - ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit - vesicle transport through interaction with t-SNAREs homolog 1A (yeast) |