Cart 4 Product Products 547,71 € (empty)
-
1 x PRPF38B-PR...113,40 € -
1 x VCY-variab...113,40 € -
1 x FAM154A-fa...121,50 € -
No products
To be determined Shipping
547,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 547,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 547,71 €
View larger 
Data sheet of SCGN-secretagogin, EF-hand calcium binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCGN-secretagogin, EF-hand calcium binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCGN |
| Origin species: | Human |
| Product name: | SCGN-secretagogin, EF-hand calcium binding protein Gene |
| Size: | 2ug |
| Accessions: | BC000336 |
| Gene id: | 10590 |
| Gene description: | secretagogin, EF-hand calcium binding protein |
| Synonyms: | CALBL; DJ501N12.8; SECRET; SEGN; setagin; secretagogin, EF-hand calcium binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagctcccgggaaccgactctggggcgcttggacgccgctggcttctggcaggtctggcagcgctttgatgcggatgaaaaaggttacatagaagagaaggaactcgatgctttctttctccacatgttgatgaaactgggtactgatgacacggtcatgaaagcaaatttgcacaaggtgaaacagcagtttatgactacccaagatgcctctaaagatggtcgcattcggatgaaagagcttgctggtatgttcttatctgaggatgaaaactttcttctgctctttcgccgggaaaacccactggacagcagcgtggagtttatgcagatttggcgcaaatatgacgctgacagcagtggctttatatcagctgctgagctccgcaacttcctccgagacctctttcttcaccacaaaaaggccatttctgaggctaaactggaagaatacactggcaccatgatgaagatttttgacagaaataaagatggtcggttggatctaaatgacttagcaaggattctggctcttcaggaaaacttccttctccaatttaaaatggatgcttgttctactgaagaaaggaaaagggactttgagaaaatctttgcctactatgatgttagtaaaacaggagccctggaaggcccagaagtggatgggtttgtcaaagacatgatggagcttgtccagcccagcatcagcggggtggaccttgataagttccgcgagattctcctgcgtcactgcgacgtgaacaaggatggaaaaattcagaagtctgagctggctttgtgtcttgggctgaaaatcaacccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 6 - DnaJ (Hsp40) homolog, subfamily B, member 5 - cadherin 6, type 2, K-cadherin (fetal kidney) - cold shock domain containing E1, RNA-binding |