Cart 1 Product Products 113,40 € (empty)
-
1 x NDUFS3-NAD...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene
PTXBC015739
New product
Data sheet of GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015739 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GZMA |
| Origin species: | Human |
| Product name: | GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene |
| Size: | 2ug |
| Accessions: | BC015739 |
| Gene id: | 3001 |
| Gene description: | granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) |
| Synonyms: | CTLA3; HFSP; granzyme A; CTL tryptase; Cytotoxic T-lymphocyte-associated serine esterase-3; Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease); Hanukah factor serine protease); cytotoxic T-lymphocyte proteinase 1; fragmentin-1; granzyme 1; granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3); h factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgattgcaaaagactgggtgttgactgcagctcactgtaacttgaacaaaaggtcccaggtcattcttggggctcactcaataaccagggaagagccaacaaaacagataatgcttgttaagaaagagtttccctatccatgctatgacccagccacacgcgaaggtgaccttaaacttttacagctgacggaaaaagcaaaaattaacaaatatgtgactatccttcatctacctaaaaagggggatgatgtgaaaccaggaaccatgtgccaagttgcagggtggggcaggactcacaatagtgcatcttggtccgatactctgagagaagtcaatatcaccatcatagacagaaaagtctgcaatgatcgaaatcactataattttaaccctgtgattggaatgaatatggtttgtgctggaagcctccgaggtggaagagactcgtgcaatggagattctggaagccctttgttgtgcgagggtgttttccgaggggtcacttcctttggccttgaaaataaatgcggagaccctcgtgggcctggtgtctatattcttctctcaaagaaacacctcaactggataattatgactatcaagggagcagtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) - eukaryotic translation initiation factor 3, subunit E interacting protein - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 - transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) |