Cart 34 Product Products 5 738,87 € (empty)
-
-
1 x ZBP1-Z-DNA...113,40 € -
-
1 x Prolactin-...744,00 € -
1 x RSPO3-R-sp...121,50 € -
1 x Prolactin324,00 € -
1 x MAPKAP1-mi...121,50 € -
1 x RAB40AL-RA...121,50 € -
1 x C20orf141-...113,40 € -
1 x CABYR-calc...121,50 € -
1 x NXNL2-nucl...113,40 € -
-
1 x PAX3-paire...121,50 € -
-
1 x CSF2-colon...113,40 € -
1 x SLC35E2-so...121,50 € -
-
-
1 x DKKL1-dick...113,40 € -
-
1 x HM13-histo...121,50 € -
1 x FBXO39-F-b...121,50 € -
1 x SIN3A-SIN3...113,40 € -
1 x Olfactory...259,07 € -
1 x RNF11-ring...113,40 € -
1 x CPI-17...259,07 € -
1 x RSPO1-R-sp...113,40 € -
-
-
-
1 x LRRC3-leuc...113,40 € -
1 x Phospho-Lc...259,07 € -
-
No products
To be determined Shipping
5 738,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 738,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 738,87 €
Data sheet of PRUNE2-prune homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRUNE2-prune homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019095 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRUNE2 |
| Origin species: | Human |
| Product name: | PRUNE2-prune homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC019095 |
| Gene id: | 158471 |
| Gene description: | prune homolog 2 (Drosophila) |
| Synonyms: | truncated PRUNE2; BMCC1; BNIPXL; C9orf65; KIAA0367; protein prune homolog 2; BCH motif-containing molecule at the carboxyl terminal region 1; BNIP2 motif containing molecule at the carboxyl terminal region 1; BNIP2 motif-containing molecule at the C-terminal region 1; olfaxin; prune homolog 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagaatttttgcaacgcgccaaatctaaactgaatcgaagcaaacgcttggagaaggtccatgtggttattgggcctaaatcgtgtgacttggattctctcatttctaccttcacatatgcttactttctagacaaggtcagtccaccaggggttctgtgtttaccagtgctgaacataccaagaactgaattcaactacttcaccgagacgaggtttattttagaagagctaaatatttccgaatcattccacatattccgggatgaaattaacctgcatcagctaaatgatgaagggaagttatcgataacacttgttggcagcagtgtgctggcgagtgaagacaaaactttagaatcagcagttgtcaaagtcattaatccggttgagcagagcgatgccaacgttgagttccgagagtcttcctcttctctcgtgctaaaggagattctccaagaggctcctgagctcatcaccgagcaactggctcatcgcctcagaggtagcattcttttcaagtggatgaccatggaatcagagaagatctcagagaagcaggaggaaattctttctatcctggaagaaaaatttcctaacttgcctccaagagaggacatcatcaacgtcctacaggagacccagttcagtgctcagggtttaagtattgaacagacaatgttgaaagatctaaaggagctgtcagatggagaaataaaagtggccattagtactgtgagcatgaaccttgaggtaagggtgggaatgcttttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kallikrein-related peptidase 3 - nucleosomal binding protein 1 - melanoma antigen family A, 9 - homer homolog 3 (Drosophila) |