Cart 28 Product Products 4 426,33 € (empty)
-
-
1 x ADA-adenos...121,50 € -
1 x BCAP31-B-c...113,40 € -
1 x CPA2-carbo...121,50 € -
-
1 x EPB41L4A-e...113,40 € -
1 x ZNF592...259,07 € -
1 x TIMP1-TIMP...113,40 € -
1 x PPP6C-prot...121,50 € -
1 x MS4A12-mem...121,50 € -
1 x PHAX-phosp...121,50 € -
1 x GAD67...259,07 € -
1 x SCAMP5-sec...113,40 € -
-
1 x ZNF296-zin...121,50 € -
1 x Phospho-Ta...259,07 € -
-
1 x DLK2-delta...113,40 € -
1 x ACTL7B-act...121,50 € -
-
-
1 x BBS5-Barde...121,50 € -
1 x ATF-3...259,07 € -
1 x PAR4...259,07 € -
-
1 x FBP1-fruct...121,50 € -
1 x TMED9-tran...113,40 € -
No products
To be determined Shipping
4 426,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 28 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 426,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 426,33 €
Data sheet of TMEM51-transmembrane protein 51 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM51-transmembrane protein 51 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000202 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM51 |
| Origin species: | Human |
| Product name: | TMEM51-transmembrane protein 51 Gene |
| Size: | 2ug |
| Accessions: | BC000202 |
| Gene id: | 55092 |
| Gene description: | transmembrane protein 51 |
| Synonyms: | C1orf72; transmembrane protein 51 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcccagtccaaggccaatggctcgcactatgcgctgaccgccatcggcctggggatgctggtccttggggtgatcatggccatgtggaacctggtacccggcttcagcgcggccgagaagccaacagctcagggcagcaacaagaccgaggtgggtggcggcatcctcaagagcaagaccttctctgtggcctacgtgctggtcggggccggggtgatgctgctgctgctttctatctgcctgagtatcagggataagaggaagcagcggcagggcgaggacctggcccatgtccagcacccgacaggcgctgggcctcacgcccaggaggaagacagccaggaggaagaagaggaggatgaggaggctgcctcaaggtactatgttcccagctacgaggaagtgatgaacacaaactactcagaagcaaggggagaggagcagaacccgaggttgagcatctctctcccgtcctatgagtcactgacggggctcgacgagaccacccccacatccaccagggctgacgtggaggccagccctgggaacccccctgacaggcagaactctaagttggccaaacgactgaaaccgctgaaagttcgaaggattaaatctgaaaagcttcacctcaaagactttaggatcaacctcccagacaaaaacgtccctcctccctcgatagagcctttgactcctccaccgcagtatgatgaagtccaggagaaggcccccgacacccggccgcccgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutamate dehydrogenase 2 - mannose phosphate isomerase - DAZ associated protein 1 - protoporphyrinogen oxidase |