Cart 25 Product Products 2 932,28 € (empty)
-
1 x NXPH3-neur...113,40 € -
1 x ILF3-inter...113,40 € -
1 x GNPTAB-N-a...113,40 € -
1 x WDR73-WD...121,50 € -
1 x CENPM-cent...113,40 € -
-
-
1 x SEPSECS-Se...121,50 € -
-
1 x CBWD1-COBW...121,50 € -
1 x WISP3-WNT1...113,40 € -
-
1 x GOLGA8G-go...121,50 € -
-
1 x ACYP2...259,07 € -
-
-
-
1 x NBL1-neuro...113,40 € -
1 x OR8B8-olfa...121,50 € -
-
-
1 x FUT9-fucos...121,50 € -
1 x ITLN1-inte...121,50 € -
No products
To be determined Shipping
2 932,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 932,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 932,28 €
View larger 
Data sheet of SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINT2 |
| Origin species: | Human |
| Product name: | SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene |
| Size: | 2ug |
| Accessions: | BC001668 |
| Gene id: | 10653 |
| Gene description: | serine peptidase inhibitor, Kunitz type, 2 |
| Synonyms: | DIAR3; HAI-2; HAI2; Kop; kunitz-type protease inhibitor 2; hepatocyte growth factor activator inhibitor type 2; placental bikunin; serine protease inhibitor, Kunitz type, 2; testicular tissue protein Li 183; serine peptidase inhibitor, Kunitz type 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcagctgtgcgggctgaggcggagccgggcgtttctcgccctgctgggatcgctgctcctctctggggtcctggcggccgaccgagaacgcagcatccacgacttctgcctggtgtcgaaggtggtgggcagatgccgggcctccatgcctaggtggtggtacaatgtcactgacggatcctgccagctgtttgtgtatgggggctgtgacggaaacagcaataattacctgaccaaggaggagtgcctcaagaaatgtgccactgtcacagagaatgccacgggtgacctggccaccagcaggaatgcagcggattcctctgtcccaagtgctcccagaaggcaggattctgaagaccactccagcgatatgttcaactatgaagaatactgcaccgccaacgcagtcactgggccttgccgtgcatccttcccacgctggtactttgacgtggagaggaactcctgcaataacttcatctatggaggctgccggggcaataagaacagctaccgctctgaggaggcctgcatgctccgctgcttccgccagcaggagaatcctcccctgccccttggctcaaaggtggtggttctggcggggctgttcgtgatggtgttgatcctcttcctgggagcctccatggtctacctgatccgggtggcacggaggaaccaggagcgtgccctgcgcaccgtctggagctccggagatgacaaggagcagctggtgaagaacacatatgtcctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alanyl-tRNA synthetase domain containing 1 - actin binding LIM protein family, member 3 - putative homeodomain transcription factor 1 - calcium binding and coiled-coil domain 1 |