Cart 25 Product Products 4 440,79 € (empty)
-
-
1 x ZBP1-Z-DNA...113,40 € -
-
1 x Prolactin-...744,00 € -
1 x RSPO3-R-sp...121,50 € -
1 x Prolactin324,00 € -
1 x MAPKAP1-mi...121,50 € -
1 x RAB40AL-RA...121,50 € -
1 x C20orf141-...113,40 € -
1 x CABYR-calc...121,50 € -
1 x NXNL2-nucl...113,40 € -
-
1 x PAX3-paire...121,50 € -
-
1 x CSF2-colon...113,40 € -
1 x SLC35E2-so...121,50 € -
-
-
1 x DKKL1-dick...113,40 € -
-
1 x HM13-histo...121,50 € -
1 x FBXO39-F-b...121,50 € -
1 x SIN3A-SIN3...113,40 € -
1 x Olfactory...259,07 € -
1 x RNF11-ring...113,40 €
No products
To be determined Shipping
4 440,79 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 440,79 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 440,79 €
View larger 
Data sheet of PNO1-partner of NOB1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PNO1-partner of NOB1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008304 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PNO1 |
| Origin species: | Human |
| Product name: | PNO1-partner of NOB1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC008304 |
| Gene id: | 56902 |
| Gene description: | partner of NOB1 homolog (S. cerevisiae) |
| Synonyms: | RNA-binding protein PNO1; KHRBP1; RRP20; KH-type RNA-binding protein 1; RNA binding protein; partner of NOB1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatccgaaatggaaacgcagagcgccagggcagaggagggctttacccaggtcacccgcaagggtggccgacgggcgaagaaacgacaggctgaacagctgtccgcagcaggagagggcggggatgcgggccgcatggacacagaggaggccaggccggcgaagaggcccgtcttcccacccctctgtggggacgggctcctgagtgggaaagaagaaacaaggaaaattccagtcccagctaacagatacacaccattgaaagaaaactggatgaagatatttactcctattgtggaacatttgggacttcagatacgctttaacttgaaatcaaggaatgtagaaatcaggacttgtaaagaaaccaaggatgttagtgctctgacaaaagcagctgattttgtgaaagcttttattctcggctttcaggtggaggatgcacttgccctcatcaggttggatgacctcttcctagagtcttttgaaattacagatgttaaacccctaaagggagaccatctatccagggcaataggaagaatcgctggcaaaggaggaaaaaccaaattcaccatagagaatgtgacacggacaaggatagttttggctgatgtgaaagttcacatccttggctccttccaaaatatcaagatggcaagaactgccatttgcaacctaatcttgggaaatcctccttccaaggtttatggcaatattcgagctgtggctagcagatcagcagatcgattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S18B - solute carrier family 25, member 33 - solute carrier family 22, member 18 - zinc finger CCCH-type containing 12A |