Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene
PTXBC001771
New product
Data sheet of GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001771 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF2F2 |
| Origin species: | Human |
| Product name: | GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene |
| Size: | 2ug |
| Accessions: | BC001771 |
| Gene id: | 2963 |
| Gene description: | general transcription factor IIF, polypeptide 2, 30kDa |
| Synonyms: | ATP-dependent helicase GTF2F2; BTF4; RAP30; TF2F2; TFIIF; general transcription factor IIF subunit 2; TFIIF-beta; general transcription factor IIF 30 kDa subunit; general transcription factor IIF, polypeptide 2, 30kDa; transcription initiation factor IIF subunit beta; transcription initiation factor RAP30 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgagcgcggggaactcgacttgaccggcgccaaacagaacacaggagtgtggctagtcaaggttcctaaatatttgtcacagcaatgggctaaagcttctggaagaggtgaagttgggaaactgcggattgccaagactcaaggaaggactgaggtgtcatttactttgaatgaggatcttgcaaatattcatgatattggtggaaaaccagcttcagtcagtgctcctagagaacatccatttgtcttgcaaagtgttggaggacagacattaacagtatttactgagagctcatcagataagctgtcattggaaggaatagtggtacaaagagctgaatgccgaccagctgccagtgaaaactacatgcgattaaaaagattgcaaatagaagagtcttccaaaccagtgaggctatcacaacagctggacaaagttgtaacaaccaattacaaacctgttgctaatcatcaatacaatatcgaatatgaaaggaaaaagaaagaagacggaaagcgagctcgagctgataaacaacatgttttagacatgctattttcagcctttgagaaacatcaatactataatcttaaggacttggtggacatcacaaaacaacctgtggtgtacctgaaggaaatcttaaaagaaattggtgttcagaatgtaaaagggatccacaaaaacacatgggagctgaagccagagtacagacactatcaaggagaagaaaagagtgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 10 - transmembrane and tetratricopeptide repeat containing 4 - eukaryotic translation initiation factor 4A, isoform 2 - G-protein signaling modulator 1 (AGS3-like, C. elegans) |