Cart 13 Product Products 1 862,09 € (empty)
-
1 x Syndecan-1...534,00 € -
-
-
1 x GGA1-golgi...113,40 € -
-
-
1 x AP1S3-adap...113,40 € -
1 x IFIT2-inte...121,50 € -
1 x APITD1-apo...113,40 € -
1 x APIP-APAF1...113,40 € -
-
-
No products
To be determined Shipping
1 862,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 862,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 862,09 €
View larger 
RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
PTXBC014095
New product
Data sheet of RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014095 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RELA |
| Origin species: | Human |
| Product name: | RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene |
| Size: | 2ug |
| Accessions: | BC014095 |
| Gene id: | 5970 |
| Gene description: | v-rel reticuloendotheliosis viral oncogene homolog A (avian) |
| Synonyms: | RELA proto-oncogene, NF-kB subunit; NFKB3; transcription factor p65; NF-kappa-B p65delta3; NF-kappa-B transcription factor p65; nuclear factor NF-kappa-B p65 subunit; nuclear factor of kappa light polypeptide gene enhancer in B-cells 3; v-rel avian reticuloendotheliosis viral oncogene homolog A; v-rel reticuloendotheliosis viral oncogene homolog A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgaactgttccccctcatcttcccggcagagccagcccaggcctctggcccctatgtggagatcattgagcagcccaagcagcggggcatgcgcttccgctacaagtgcgaggggcgctccgcgggcagcatcccaggcgagaggagcacagataccaccaagacccaccccaccatcaagatcaatggctacacaggaccagggacagtgcgcatctccctggtcaccaaggaccctcctcaccggcctcacccccacgagcttgtaggaaaggactgccgggatggcttctatgaggctgagctctgcccggaccgctgcatccacagtttccagaacctgggaatccagtgtgtgaagaagcgggacctggagcaggctatcagtcagcgcatccagaccaacaacaaccccttccaagttcctatagaagagcagcgtggggactacgacctgaatgctgtgcggctctgcttccaggtgacagtgcgggacccatcaggcaggcccctccgcctgccgcctgtcctttctcatcccatctttgacaatcgtgcccccaacactgccgagctcaagatctgccgagtgaaccgaaactctggcagctgcctcggtggggatgagatcttcctactgtgtgacaaggtgcagaaagaggacattgaggtgtgtccccaagccagcaccccagccctatccctttacgtcatccctgagcaccatcaactatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small nuclear RNA activating complex, polypeptide 1, 43kDa - eukaryotic translation initiation factor 2-alpha kinase 1 - ADAM metallopeptidase with thrombospondin type 1 motif, 1 - integrin, alpha 5 (fibronectin receptor, alpha polypeptide) |