Cart 1 Product Products 121,50 € (empty)
-
1 x IMPACT-Imp...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of MDFI-MyoD family inhibitor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MDFI-MyoD family inhibitor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007836 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MDFI |
| Origin species: | Human |
| Product name: | MDFI-MyoD family inhibitor Gene |
| Size: | 2ug |
| Accessions: | BC007836 |
| Gene id: | 4188 |
| Gene description: | MyoD family inhibitor |
| Synonyms: | I-MF; I-mfa; myoD family inhibitor; inhibitor of MyoD family a; myogenic repressor I-mf |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtaccaggtgagcggccagcgcccctctggctgcgacgcgccctatggagcccccagcgcagccccgggcccagcccagaccctatccctccttcctgggctggaggtagtaacaggatccactcaccctgcggaggcagcaccagaggagggctccctggaggaggcggcaacccccatgccccaaggcaatggccctggcatcccccagggcctggacagcactgacctcgacgtccccacagaagctgtgacatgccagcctcaggggaaccccttgggctgcaccccacttctgccgaatgactctggccacccctcagagctgggcggcaccagacgggcggggaatggtgccctgggtggccccaaggcccaccggaagttgcagacacacccatctctcgccagccagggcagcaagaagagtaagagcagcagcaaatccaccacctcccagatccccctccaggcacaggaagactgctgtgtccactgcatcctgtcctgcctgttctgcgagttcctgacgctgtgcaacatcgtcctggactgcgccacctgtggctcctgcagctcggaggactcgtgcctctgctgctgctgctgtggctctggcgagtgtgccgactgcgacctgccctgcgacctggactgcggcatcctggatgcctgctgcgagtccgcggactgcctggagatctgcatggagtgctgtgggctctgcttctcctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SMAD family member 4 - lysyl-tRNA synthetase - nucleolar protein 10 - tousled-like kinase 1 |