Cart 8 Product Products 1 069,07 € (empty)
-
1 x TAF11-TAF1...113,40 € -
1 x NDFIP1-Ned...113,40 € -
1 x PHKG2-phos...121,50 € -
1 x CNBP-CCHC-...113,40 € -
1 x Laminin...259,07 € -
1 x GOLM1-golg...121,50 € -
1 x RAB35-RAB3...113,40 € -
1 x RPS19-ribo...113,40 €
No products
To be determined Shipping
1 069,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 069,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 069,07 €
View larger 
PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
PTXBC015918
New product
Data sheet of PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015918 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PMEPA1 |
| Origin species: | Human |
| Product name: | PMEPA1-prostate transmembrane protein, androgen induced 1 Gene |
| Size: | 2ug |
| Accessions: | BC015918 |
| Gene id: | 56937 |
| Gene description: | prostate transmembrane protein, androgen induced 1 |
| Synonyms: | STAG1; TMEPAI; protein TMEPAI; solid tumor-associated 1 protein; transmembrane, prostate androgen induced RNA; prostate transmembrane protein, androgen induced 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggtgatggtggtggtgatcacgtgcctgctgagccactacaagctgtctgcacggtccttcatcagccggcacagccaggggcggaggagagaagatgccctgtcctcagaaggatgcctgtggccctcggagagcacagtgtcaggcaacggaatcccagagccgcaggtctacgccccgcctcggcccaccgaccgcctggccgtgccgcccttcgcccagcgggagcgcttccaccgcttccagcccacctatccgtacctgcagcacgagatcgacctgccgcccaccatctcgctgtcagacggggaggagcccccaccctaccagggcccctgcaccctccagcttcgggaccccgagcagcagctggaactgaaccgggagtcggtgcgcgcacccccaaacagaaccatcttcgacagtgacctgatggatagtgccaggctgggcggcccctgcccccccagcagtaactcgggcatcagcgccacgtgctacggcagcggcgggcgcatggaggggccgccgcccacctacagcgaggtcatcggccactacccggggtcctccttccagcaccagcagagcagtgggccgccctccttgctggaggggacccggctccaccacacacacatcgcgcccctagagagcgcagccatctggagcaaagagaaggataaacagaaaggacaccctctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alcohol dehydrogenase 5 (class III), chi polypeptide - glucocorticoid modulatory element binding protein 1 - vacuolar protein sorting 53 homolog (S. cerevisiae) - ATPase, H+ transporting, lysosomal V0 subunit a1 |