Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
STT3B-STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) Gene
PTXBC015880
New product
Data sheet of STT3B-STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STT3B-STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015880 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STT3B |
| Origin species: | Human |
| Product name: | STT3B-STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC015880 |
| Gene id: | 201595 |
| Gene description: | STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) |
| Synonyms: | STT3B, catalytic subunit of the oligosaccharyltransferase complex; oligosaccharyl transferase subunit STT3B; STT3B, subunit of the oligosaccharyltransferase complex (catalytic); dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B; CDG1X; SIMP; STT3-B; STT3, subunit of the oligosaccharyltransferase complex, homolog B; dolichyl-diphosphooligosaccharide protein glycotransferase; homolog of yeast STT3; source of immunodominant MHC-associated peptides homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttggtgggattatggctatcagatagctggaatggctaatagaactacgttggtggataataacacctggaataacagccacatagcactggtgggaaaagctatgtcttctaatgaaacagcagcctataaaatcatgaggactctagatgtagattatgttttggttatttttggaggggttattggctattctggtgatgatatcaacaaatttctctggatggttaggatagctgaaggagaacatcccaaagacattcgggaaagtgactattttaccccacagggagaattccgtgtagacaaagcaggatcccctactttgttgaattgccttatgtataaaatgtcatactacagatttggagaaatgcagctggattttcgtacacccccaggttttgaccgaacacgtaatgctgagattggaaataaggacattaaattcaaacatttggaagaagcctttacatcagaacactggcttgttaggatatataaagtaaaagcacctgataacagggagacattagatcacaaacctcgagtcaccaacattttcccaaaacagaagtatttgtcaaagaagactaccaaaaggaagcgtggctacattaaaaataagctggtttttaagaaaggcaagaaaatatttaagaagactgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 - solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 - fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) - solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 |