Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UBE2S-ubiquitin-conjugating enzyme E2S Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2S-ubiquitin-conjugating enzyme E2S Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004236 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2S |
| Origin species: | Human |
| Product name: | UBE2S-ubiquitin-conjugating enzyme E2S Gene |
| Size: | 2ug |
| Accessions: | BC004236 |
| Gene id: | 27338 |
| Gene description: | ubiquitin-conjugating enzyme E2S |
| Synonyms: | E2-EPF; E2EPF; EPF5; ubiquitin-conjugating enzyme E2 S; E2 ubiquitin-conjugating enzyme S; E2-EPF5; ubiquitin carrier protein S; ubiquitin conjugating enzyme E2S; ubiquitin-conjugating enzyme E2-24 kD; ubiquitin-conjugating enzyme E2-24 kDa; ubiquitin-conjugating enzyme E2-EPF5; ubiquitin-protein ligase S; ubiquitin conjugating enzyme E2 S |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtctgttccgcatgaaactcctgctggggaaggacttccctgcctccccccccaagggctacttcctgaccaagatcttccacccgaacgtgggcgccaatggcgagatctgcgtcaacgtgctcaagagggactggacggctgagctgggcatccgacacgtactgctgaccatcaagtgcctgctgatccaccctaaccccgagtctgcactcaacgaggaggcgggccgcctgctcttggagaactacgaggagtatgcagctcgggcccgtctgctcacagagatccacgggggcgccggcgggcccagcggcagggccgaagccggtcgggccctggccagtggcactgaagcttcctccaccgaccctggggccccagggggcccgggaggggctgagggtcccatggccaagaagcatgctggcgagcgcgataagaagctggcggccaagaaaaagacggacaagaagcgggcgctgcggcggctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth differentiation factor 15 - calcium homeostasis modulator 2 - TNF receptor-associated factor 4 - glucose-6-phosphate dehydrogenase |