Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR3GL-polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like Gene
PTXBC004355
New product
Data sheet of POLR3GL-polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR3GL-polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004355 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR3GL |
| Origin species: | Human |
| Product name: | POLR3GL-polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like Gene |
| Size: | 2ug |
| Accessions: | BC004355 |
| Gene id: | 84265 |
| Gene description: | polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like |
| Synonyms: | RPC32HOM; flj32422; DNA-directed RNA polymerase III subunit RPC7-like; DNA-directed RNA polymerase III subunit G-like; RNA polymerase III subunit C7-like; RPC32-like protein; alternative RNA polymerase III subunit 32; polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like; polymerase (RNA) III subunit G like; RNA polymerase III subunit G like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagccggggtgggggccggggtcgtggccggggccagttgaccttcaacgtggaggccgtgggcattgggaaaggggatgctttgcccccacccaccctgcagccttctccactcttccctcccttggagttccgcccagtacctttgccctcaggcgaggaaggggaatatgtcctggcactgaagcaagagctacgaggagccatgaggcagctcccctacttcatccggccagctgtccccaagagagatgtggagcgttattcagacaaatatcagatgtcaggtccgattgacaatgccatcgattggaaccctgattggcggcgtctaccccgggagctaaagatccgagtgcggaagctacagaaggaacggattacaattctgctccccaagaggccccctaagaccacagaagataaggaggaaacaatacagaaactagagaccctggagaagaaggaagaagaagtaacttcagaggaggatgaggagaaagaagaagaagaagagaaggaagaggaggaagaagaagagtatgatgaagaagaacatgaagaggaaactgattacatcatgtcatattttgacaatggagaggactttggtggtgacagtgatgacaatatggacgaggctatatactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) - heat shock protein 90kDa alpha (cytosolic), class B member 1 - dysbindin (dystrobrevin binding protein 1) domain containing 2 - single-strand-selective monofunctional uracil-DNA glycosylase 1 |