> >>RGS20-regulator of G-protein signaling 20 Gene
RGS20-regulator of G-protein signaling 20 Gene View larger

RGS20-regulator of G-protein signaling 20 Gene

PTXBC015614

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of RGS20-regulator of G-protein signaling 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS20-regulator of G-protein signaling 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015614
Product type: DNA & cDNA
Ncbi symbol: RGS20
Origin species: Human
Product name: RGS20-regulator of G-protein signaling 20 Gene
Size: 2ug
Accessions: BC015614
Gene id: 8601
Gene description: regulator of G-protein signaling 20
Synonyms: ZGAP1; g(z)GAP; gz-GAP; regulator of G-protein signaling 20; gz-selective GTPase-activating protein; regulator of G-protein signaling 20 variant 2; regulator of G-protein signaling Z1; regulator of G-protein signalling 20; regulator of Gz-selective protein signaling 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagaggcccacaatagcttcccacgaactcagagcagatcttccaacctgggaagaaagccctgctcctactctggaagaagtcaacgcctgggctcagtcatttgacaaattaatggtcactccagcaggaaggaatgcattccgtgaattcctccgaacagaattcagtgaggaaaatatgctcttctggatggcctgtgaggaactgaaaaaggaagctaataaaaacattattgaagagaaagcaaggataatctatgaagactacatttctatactttctcctaaggaggtgagcttagactcccgggtgagagaagtgatcaacagaaacatggtggagccatcccaacacatattcgatgatgctcaacttcagatttacaccctgatgcacagagactcatatcctcgattcatgaactctgctgtctataaggacttgcttcagtccttatcggagaaatctattgaagcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Nedd4 family interacting protein 2
- nipsnap homolog 3A (C. elegans)
- inhibitor of growth family, member 4
- abhydrolase domain containing 14A

Reviews

Buy RGS20-regulator of G-protein signaling 20 Gene now

Add to cart