ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene View larger

ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene

PTXBC015569

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015569
Product type: DNA & cDNA
Ncbi symbol: ARL6IP4
Origin species: Human
Product name: ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene
Size: 2ug
Accessions: BC015569
Gene id: 51329
Gene description: ADP-ribosylation-like factor 6 interacting protein 4
Synonyms: SFRS20; SR-25; SRp25; SRrp37; ADP-ribosylation factor-like protein 6-interacting protein 4; ADP-ribosylation factor GTPase 6 interacting protein 4; ADP-ribosylation factor-like 6 interacting protein 4; ADP-ribosylation-like factor 6 interacting protein 4; ARL-6-interacting protein 4; HSP-975; HSVI binding protein; SR-15; SRp25 nuclear protein; aip-4; splicing factor SRrp37; splicing factor, arginine/serine-rich 20; splicing regulator SRrp38; ADP ribosylation factor like GTPase 6 interacting protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcacgtcggctcccgcaagcgctcgaggagtcgcagccggtcccggggacgggggtcggaaaagagaaagaagaagagcaggaaagacacctcgaggaactgctcggcctccacatcccaagagagaagcaagcagaaggcccggaggagaacaagatccagctcctcctcctcttcttccagttcttctagctcctcttcttcctcctcgtcctcctcctcttcctccagtgatggccggaagaagcgggggaagtacaaggacaagaggaggaagaagaagaagaagaggaagaagctgaagaagaagggcaaggagaaggcggaagcacagcaggtggaggctctgccgggcccctcgctggaccagtggcaccgatcagctggggaggaagaggatggcccagtcctgacggatgagcagaagtcccgaatccaggccatgaagcccatgaccaaggaggagtgggatgcccggcagagcatcatccgcaaggtggtggaccctgagacggggcgcaccaggcttattaagggagatggcgaggtcctagaggaaatcgtaaccaaagaacgacacagagagatcaacaaggtgggtgtggcccctctgcctgccatccgcccccagctctgtttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THAP domain containing, apoptosis associated protein 2
- proteasome (prosome, macropain) subunit, alpha type, 3
- proteasome (prosome, macropain) subunit, alpha type, 4
- proteasome (prosome, macropain) subunit, alpha type, 1

Reviews

Buy ARL6IP4-ADP-ribosylation-like factor 6 interacting protein 4 Gene now

Add to cart