Cart 4 Product Products 460,25 € (empty)
-
-
1 x PTGR2-pros...121,50 € -
-
1 x PDCL3-phos...113,40 €
No products
To be determined Shipping
460,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 460,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 460,25 €
Data sheet of PCTP-phosphatidylcholine transfer protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PCTP-phosphatidylcholine transfer protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012084 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PCTP |
| Origin species: | Human |
| Product name: | PCTP-phosphatidylcholine transfer protein Gene |
| Size: | 2ug |
| Accessions: | BC012084 |
| Gene id: | 58488 |
| Gene description: | phosphatidylcholine transfer protein |
| Synonyms: | PC-TP; STARD2; phosphatidylcholine transfer protein; START domain-containing protein 2; StAR-related lipid transfer (START) domain containing 2; stAR-related lipid transfer protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgttctggaggactgctcaccaactctactggcagacatctatatggactcagattacagaaaacaatgggaccagtatgttaaagaactctatgaacaagaatgcaacggagagactgtggtctactgggaagtgaagtacccttttcccatgtccaacagagactatgtctaccttcggcagcggcgagacctggacatggaagggaggaagatccatgtgatcctggcccggagcacctccatgcctcagcttggcgagaggtctggggtgatccgggtgaagcaatacaagcagagcctggcgattgagagtgacggcaagaaggggagcaaagttttcatgtattacttcgataacccgggtggccaaattccgtcctggctcattaactgggccgccaagaatggagttcctaacttcttgaaagacatggcaagagcctgtcagaactacctcaagaaaacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of G-protein signaling 20 - Nedd4 family interacting protein 2 - nipsnap homolog 3A (C. elegans) - inhibitor of growth family, member 4 |