Cart 21 Product Products 2 424,96 € (empty)
-
1 x C15orf5-ch...113,40 € -
1 x C5orf45-ch...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x ATP5L-ATP...113,40 € -
1 x HNRPDL-het...121,50 € -
-
1 x C19orf36-c...113,40 € -
1 x MED27-medi...113,40 € -
1 x NOSTRIN-ni...121,50 € -
1 x FAM102A-fa...113,40 € -
1 x TIGIT-T...113,40 € -
1 x ADAM18-ADA...113,40 € -
1 x CREBZF-CRE...121,50 € -
1 x C1orf158-c...113,40 € -
-
1 x GNPNAT1-gl...113,40 € -
1 x C1orf109-c...113,40 € -
1 x C4orf37-ch...121,50 € -
1 x REEP1-rece...113,40 € -
1 x SMARCB1-SW...121,50 € -
1 x SLA-Src-li...121,50 €
No products
To be determined Shipping
2 424,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 424,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 424,96 €
Data sheet of MRPL48-mitochondrial ribosomal protein L48 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL48-mitochondrial ribosomal protein L48 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009764 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL48 |
| Origin species: | Human |
| Product name: | MRPL48-mitochondrial ribosomal protein L48 Gene |
| Size: | 2ug |
| Accessions: | BC009764 |
| Gene id: | 51642 |
| Gene description: | mitochondrial ribosomal protein L48 |
| Synonyms: | CGI-118; HSPC290; L48MT; MRP-L48; 39S ribosomal protein L48, mitochondrial; mitochondrial ribosomal protein L48 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcggaaccttgggaaaggtgctgtgcctgaggaacaataccatttttaagcaagccttttctctcttaaggtttagaacttcaggagagaagcccatctattctgtaggtggaattctactaagtatcagtcggccctacaagacaaagcccacccacggcattggaaagtacaagcacttaattaaagcagaagagcccaagaagaagaagggaaaagtggaagtgagagccattaatttggggacagattatgaatatggggttttaaatattcatctgactgcatatgatatgaccctggcagagagttatgcccagtatgttcacaacctctgcaactctctctccattaaagtcgaggaaagttatgcaatgccaaccaaaaccatagaagtgttgcagttgcaggaccaaggcagcaaaatgctcctggactcagtgcttaccacccatgagcgagtggttcagatcagcggtttgagtgctacgtttgcagaaattttcttggaaataatccaaagcagtcttcctgaaggagtcagactgtcagtgaaggagcacactgaagaagacttcaagggacgattcaaagctcgaccagaactggaagaactgttggccaagttgaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chorionic somatomammotropin hormone 2 - mitochondrial ribosomal protein S34 - epididymal sperm binding protein 1 - chromosome 7 open reading frame 36 |