Cart 2 Product Products 234,90 € (empty)
-
1 x RMND1-requ...113,40 € -
1 x MGLL-monog...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene
PTXBC013360
New product
Data sheet of PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013360 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R8 |
| Origin species: | Human |
| Product name: | PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene |
| Size: | 2ug |
| Accessions: | BC013360 |
| Gene id: | 5511 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 8 |
| Synonyms: | ARD-1; ARD1; NIPP-1; NIPP1; PRO2047; nuclear inhibitor of protein phosphatase 1; RNase E; activator of RNA decay; nuclear inhibitor of protein phosphatase-1 alpha; nuclear inhibitor of protein phosphatase-1 beta; nuclear subunit of PP-1; protein phosphatase 1, regulatory (inhibitor) subunit 8; protein phosphatase 1 regulatory subunit 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtggagaggatgatgaactcaagggcttactggggcttccagaggaggaaactgagcttgataacctgacagagttcaacactgcccacaacaagcggatttctacccttaccattgaggagggaaatctggacattcaaagaccaaagaggaagaggaagaactcacgggtgacattcagtgaggatgatgagatcatcaacccagaggatgtggatccctcagttggtcgattcaggaacatggtgcaaactgcagtggtcccagtcaagaagaagcgtgtggagggccctggctccctgggcctggaggaatcagggagcaggcgcatgcagaactttgccttcagcggaggactctacgggggcctgccccccacacacagtgaagcaggctcccagccacatggcatccatgggacagcactcatcggtggcttgcccatgccatacccaaaccttgcccctgatgtggacttgactcctgttgtgccgtcagcagtgaacatgaaccctgcaccaaaccctgcagtctataaccctgaagctgtaaatgaacccaagaagaagaaatatgcaaaagaggcttggccaggcaagaagcccacaccttccttgctgatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 6 - major histocompatibility complex, class II, DP beta 1 - major histocompatibility complex, class II, DP beta 1 - major histocompatibility complex, class II, DQ beta 1 |