Cart 13 Product Products 1 630,59 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
-
-
1 x C11orf67-c...113,40 € -
1 x CALML3-cal...113,40 € -
1 x BNIP3L-BCL...113,40 € -
1 x MYH4...259,07 € -
1 x CXCL16-che...121,50 €
No products
To be determined Shipping
1 630,59 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 630,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 630,59 €
View larger 
COPS8-COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) Gene
PTXBC003090
New product
Data sheet of COPS8-COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COPS8-COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003090 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COPS8 |
| Origin species: | Human |
| Product name: | COPS8-COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) Gene |
| Size: | 2ug |
| Accessions: | BC003090 |
| Gene id: | 10920 |
| Gene description: | COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) |
| Synonyms: | CSN8; SGN8; COP9 signalosome complex subunit 8; COP9 constitutive photomorphogenic homolog subunit 8; COP9 homolog; JAB1-containing signalosome subunit 8; hCOP9; signalosome subunit 8; COP9 signalosome subunit 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagtggcggtgatggcggaaagcgcctttagtttcaaaaagttgctggatcagtgcgagaaccaggagctcgaggcccctggaggaattgctacacccccagtgtatggtcagcttctagctttatatttgctccataatgacatgaataatgcaagatatctttggaaaagaataccacctgctataaaatctgcaaattctgaacttgggggaatttggtcagtaggacaaagaatctggcagagagatttccctgggatctatacaaccatcaacgctcaccagtggtctgagacggtccagccaattatggaagcacttagagatgcaacaaggagacgcgcctttgccctggtctctcaagcgtatacttcaatcatcgccgatgattttgcagcctttgttggacttcctgtagaagaggctgtgaaaggcatattagaacaaggatggcaagctgattccaccacaagaatggttctgcccagaaagccagttgcaggggccctggatgtttcctttaacaagtttattcccttatcagagcctgctccagttcccccaatacccaatgaacagcagttagccagactgacggattatgtggctttccttgaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) - required for meiotic nuclear division 5 homolog A (S. cerevisiae) - protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase - integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) |