Cart 13 Product Products 1 630,59 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
-
-
1 x C11orf67-c...113,40 € -
1 x CALML3-cal...113,40 € -
1 x BNIP3L-BCL...113,40 € -
1 x MYH4...259,07 € -
1 x CXCL16-che...121,50 €
No products
To be determined Shipping
1 630,59 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 630,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 630,59 €
View larger 
MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene
PTXBC011864
New product
Data sheet of MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011864 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYCL1 |
| Origin species: | Human |
| Product name: | MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene |
| Size: | 2ug |
| Accessions: | BC011864 |
| Gene id: | 4610 |
| Gene description: | v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) |
| Synonyms: | MYCL1; L-Myc; LMYC; bHLHe38; protein L-Myc; class E basic helix-loop-helix protein 38; l-myc-1 proto-oncogene; myc-related gene from lung cancer; protein L-Myc-1; v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived; v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactacgactcgtaccagcactatttctacgactatgactgcggggaggatttctaccgctccacggcgcccagcgaggacatctggaagaaattcgagctggtgccatcgccccccacgtcgccgccctggggcttgggtcccggcgcaggggacccggcccccgggattggtcccccggagccgtggcccggagggtgcaccggagacgaagcggaatcccggggccactcgaaaggctggggcaggaactacgcctccatcatacgccgtgactgcatgtggagcggcttctcggcccgggaacggctggagagagctgtgagcgaccggctcgctcctggcgcgccccgggggaacccgcccaaggcgtccgccgccccggactgcactcccagcctcgaagccggcaacccggcgcccgccgccccctgtccgctgggcgaacccaagacccaggcctgctccgggtccgagagcccaagcgactcgggtaaggacctccccgagccatccaagagggggccaccccatgggtggccaaagctctgcccctgcctgaggtcaggcattggctcttctcaagctcttgggccatctccgcctctctttggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic cation transporter), member 18 antisense - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) - sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) |