Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RAB7L1-RAB7, member RAS oncogene family-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAB7L1-RAB7, member RAS oncogene family-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002585 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAB7L1 |
| Origin species: | Human |
| Product name: | RAB7L1-RAB7, member RAS oncogene family-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC002585 |
| Gene id: | 8934 |
| Gene description: | RAB7, member RAS oncogene family-like 1 |
| Synonyms: | RAB7L1; RAB7L; ras-related protein Rab-7L1; RAB7, member RAS oncogene family-like 1; rab-7-like protein 1; ras-related protein Rab-29; RAB29, member RAS oncogene family |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcagccgcgaccacctgttcaaagtgctggtggtgggggacgccgcagtgggcaagacgtcgctggtgcagcgatattcccaggacagcttcagcaaacactacaagtccacggtgggagtggattttgctctgaaggttctccagtggtctgactacgagatagtgcggcttcagctgtgggatattgcagggcaggagcgcttcacctctatgacacgattgtattatcgggatgcctctgcctgtgttattatgtttgacgttaccaatgccactaccttcagcaacagccagaggtggaaacaggacctagacagcaagctcacactacccaatggagagccggtgccctgcctgctcttggccaacaagtgtgatctgtccccttgggcagtgagccgggaccagattgaccggttcagtaaagagaacggtttcacaggttggacagaaacatcagtcaaggagaacaaaaatattaatgaggctatgagagtcctcattgaaaagatgatgagaaattccacagaagatatcatgtctttgtccacccaaggggactacatcaatctacaaaccaagtcctccagctggtcctgctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 14 open reading frame 179 - hypoxanthine phosphoribosyltransferase 1 - isopentenyl-diphosphate delta isomerase 1 - isopentenyl-diphosphate delta isomerase 1 |