Cart 26 Product Products 4 637,34 € (empty)
-
1 x CCNG1-cycl...121,50 € -
1 x KTI12-KTI1...121,50 € -
-
-
1 x TM-CYFRA 21-1399,00 € -
-
-
-
1 x TSH...449,00 € -
1 x HP-haptogl...113,40 € -
1 x EXOSC7-exo...121,50 € -
1 x Histone H3...259,07 € -
-
1 x PDRG1-p53...113,40 € -
1 x IFITM1-int...113,40 € -
1 x LGALS3-lec...113,40 € -
1 x SLC39A3-so...113,40 € -
1 x GGT1-gamma...113,40 € -
-
-
1 x HDAC11-his...121,50 € -
-
-
1 x hCG_201827...113,40 € -
1 x SRGN-sergl...113,40 € -
No products
To be determined Shipping
4 637,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 637,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 637,34 €
Data sheet of KIF26A-kinesin family member 26A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIF26A-kinesin family member 26A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009415 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIF26A |
| Origin species: | Human |
| Product name: | KIF26A-kinesin family member 26A Gene |
| Size: | 2ug |
| Accessions: | BC009415 |
| Gene id: | 26153 |
| Gene description: | kinesin family member 26A |
| Synonyms: | KIF26A variant protein; kinesin-like protein KIF26A; kinesin family member 26A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgagagtggggctgcctccccaggcgcccgcacccgcagcctcaagtcccccaagaagagggccacaggtctgcagcggcggcgcctgattcccgccccactgcccgacaccactgccctgggccgtaagcccagcctccccgggcagtgggtggacctgcccccgcccctggctggctccctgaaggagccgttcgagatcaaggtgtacgagatcgatgacgtggagcgccttcagcggccccgccccaccccgagggaggcccccacccagggtctggcgtgcgtcagtacaaggctgcggctggcggagcgcaggcagcagcggctgcgggaggtgcaggccaagcacaagcacctgtgtgaggagctggccgagacccagggccggctgatgctggagcctggccgctggctggagcagtttgaggtggacccggagctggagcccgagtcggccgagtacctggcggccctggagcgagccacggcggccctggagcagtgcgtgaacctgtgcaaggcgcacgtcatgatggtcacctgcttcgacatcagcgttgcagccagtgctgccatcccggggccgcaggaggtggacgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat domain 10 - sperm associated antigen 7 - serine/threonine kinase 40 - lysophospholipase-like 1 |