Cart 3 Product Products 340,20 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
View larger 
Data sheet of TM4SF18-transmembrane 4 L six family member 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TM4SF18-transmembrane 4 L six family member 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014339 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TM4SF18 |
| Origin species: | Human |
| Product name: | TM4SF18-transmembrane 4 L six family member 18 Gene |
| Size: | 2ug |
| Accessions: | BC014339 |
| Gene id: | 116441 |
| Gene description: | transmembrane 4 L six family member 18 |
| Synonyms: | L6D; transmembrane 4 L6 family member 18; transmembrane 4 L six family member 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtctcggaagtgtggaggctgcctaagttgtttgctgattccgcttgcactttggagtataatcgtgaacatattattgtatttcccgaatgggcaaacttcctatgcatccagcaataaactcaccaactacgtgtggtattttgaaggaatctgtttctcaggcatcatgatgcttatagtaacaacagttcttctggtactggagaataataacaactataaatgttgccagagtgaaaactgcagcaaaaaatatgtgacactgctgtcaattatcttttcttccctcggaattgctttttctggatactgcctggtcatctctgccttgggtcttgtccaagggccatattgccgcacccttgatggctgggagtatgcttttgaaggcactgctggacgtttccttacagattctagcatatggattcagtgcctggaacctgcacatgttgtggagtggaacatcattttattttccattctcataaccctcagtgggcttcaagtgatcatctgcctcatcagagtagtcatgcaactatccaagatactgtgtggaagctattcagtgatcttccagcctggaatcatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 3, member B - RAB7, member RAS oncogene family-like 1 - chromosome 14 open reading frame 179 - hypoxanthine phosphoribosyltransferase 1 |