Cart 2 Product Products 237,38 € (empty)
-
-
1 x PTGR2-pros...121,50 €
No products
To be determined Shipping
237,38 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 237,38 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 237,38 €
Data sheet of ORM2-orosomucoid 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ORM2-orosomucoid 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015964 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ORM2 |
| Origin species: | Human |
| Product name: | ORM2-orosomucoid 2 Gene |
| Size: | 2ug |
| Accessions: | BC015964 |
| Gene id: | 5005 |
| Gene description: | orosomucoid 2 |
| Synonyms: | AGP-B; AGP-B'; AGP2; alpha-1-acid glycoprotein 2; AGP 2; OMD 2; alpha-1-acid glycoprotein, type 2; orosomucoid 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttactttacccccaacaagacagaggacacgatctttctcagagagtaccagacccgccagaaccagtgcttctataactccagttacctgaatgtccagcgggagaatgggaccgtctccagatacgagggaggccgagaacatgttgctcacctgctgttccttagggacaccaagaccttgatgtttggttcctacctggacgatgagaagaactgggggctgtctttctatgctgacaagccagagacgaccaaggagcaactgggagagttctacgaagctctcgactgcttgtgcattcccaggtcagatgtcatgtacaccgactggaaaaaggataagtgtgagccactggagaagcagcacgagaaggagaggaaacaggaggagggggaatcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2-like 1 - CD81 molecule - CD58 molecule - CD48 molecule |