Cart 3 Product Products 340,20 € (empty)
-
1 x HIST1H4A-h...113,40 € -
1 x C5orf23-ch...113,40 € -
1 x CSDC2-cold...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of SRI-sorcin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SRI-sorcin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011025 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SRI |
| Origin species: | Human |
| Product name: | SRI-sorcin Gene |
| Size: | 2ug |
| Accessions: | BC011025 |
| Gene id: | 6717 |
| Gene description: | sorcin |
| Synonyms: | CP-22; CP22; SCN; V19; 22 kDa protein; H_RG167B05.1; calcium binding protein amplified in mutlidrug-resistant cells |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgacacagtctggcattgctggaggatacaaaccttttaacctggagacttgccggcttatggtttcaatgctggatagagatatgtctggcacaatgggtttcaatgaatttaaagaactctgggctgtactgaatggctggagacaacactttatcagttttgacactgacaggagtggaacagtagacccacaagaattgcagaaggccctgacaacaatgggatttaggttgagtccccaggctgtgaattcaattgcaaaacgatacagcaccaatggaaagatcaccttcgacgactacatcgcctgctgcgtcaaactgagggctcttacagacagctttcgaagacgggatactgctcagcaaggtgttgtgaatttcccatatgatgatttcattcaatgtgtcatgagtgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepsin - zinc finger protein 687 - zinc finger protein 646 - elaC homolog 2 (E. coli) |