Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DUSP13-dual specificity phosphatase 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP13-dual specificity phosphatase 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009778 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP13 |
| Origin species: | Human |
| Product name: | DUSP13-dual specificity phosphatase 13 Gene |
| Size: | 2ug |
| Accessions: | BC009778 |
| Gene id: | 51207 |
| Gene description: | dual specificity phosphatase 13 |
| Synonyms: | BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP; dual specificity protein phosphatase 13; branching-enzyme interacting DSP; branching-enzyme interacting dual-specificity protein phosphatase; muscle-restricted DSP; testis- and skeletal-muscle-specific DSP; dual specificity phosphatase 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactcactgcagaagcaggacctccggaggcccaagatccatggggcagtccaggcatctccctaccagccgcccacattggcttcgctgcagcgcttgctgtgggtccgtcaggctgccacactgaaccatatcgatgaggtctggcccagcctcttcctgggagatgcgtacgcagcccgggacaagagcaagctgatccagctgggaatcacccacgttgtgaatgccgctgcaggcaagttccaggtggacacaggtgccaaattctaccgtggaatgtccctggagtactatggcatcgaggcggatgacaaccccttcttcgacctcagtgtctactttctgcctgttgctcgatacatccgagctgccctcagtgttccccaaggccgcgtgctggtacactgtgccatgggggtaagccgctctgccacacttgtcctggccttcctcatgatctatgagaacatgacgctggtagaggccatccagacggtgcaggcccaccgcaatatctgccctaactcaggcttcctccggcagctccaggttctggacaaccgactggggcgggagacggggcggttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - activating transcription factor 6 - ubiquitin-conjugating enzyme E2S - growth differentiation factor 15 - calcium homeostasis modulator 2 |