Cart 2 Product Products 214,82 € (empty)
No products
To be determined Shipping
214,82 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 214,82 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 214,82 €
Data sheet of POFUT1-protein O-fucosyltransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POFUT1-protein O-fucosyltransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000582 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POFUT1 |
| Origin species: | Human |
| Product name: | POFUT1-protein O-fucosyltransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC000582 |
| Gene id: | 23509 |
| Gene description: | protein O-fucosyltransferase 1 |
| Synonyms: | DDD2; FUT12; O-FUT; O-Fuc-T; O-FucT-1; OFUCT1; GDP-fucose protein O-fucosyltransferase 1; o-fucosyltransferase protein; peptide-O-fucosyltransferase 1; protein O-fucosyltransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgccgccgcgtgggcacggccgctgagcgtgtctttcctgctgctgcttctgccgctcccggggatgcctgcgggctcctgggacccggccggttacctgctctactgcccctgcatggggcgctttgggaaccaggccgatcacttcttgggctctctggcatttgcaaagctgctaaaccgtaccttggctgtccctccttggattgagtaccagcatcacaagcctcctttcaccaacctccatgtgtcctaccagaagtacttcaagctggagcccctccaggcttaccatcgggtcatcagcttggaggatttcatggagaagctggcacccacccactggccccctgagaagcgggtggcatactgctttgaggtggcagcccagcgaagcccagataagaagacgtgccccatgaaggaaggaaacccctttggcccattctgggatcagtttcatgtgagtttcaacaagtcggagctttttacaggcatttccttcagtgcttcctacagagaacaatggagccagaggcgtgagaatcactcctgtgttaccttactcttcccaaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromatin modifying protein 1B - zinc finger, AN1-type domain 5 - chromatin modifying protein 4C - armadillo repeat containing 10 |