> >>MRPS23-mitochondrial ribosomal protein S23 Gene
MRPS23-mitochondrial ribosomal protein S23 Gene View larger

MRPS23-mitochondrial ribosomal protein S23 Gene

PTXBC000242

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MRPS23-mitochondrial ribosomal protein S23 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS23-mitochondrial ribosomal protein S23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000242
Product type: DNA & cDNA
Ncbi symbol: MRPS23
Origin species: Human
Product name: MRPS23-mitochondrial ribosomal protein S23 Gene
Size: 2ug
Accessions: BC000242
Gene id: 51649
Gene description: mitochondrial ribosomal protein S23
Synonyms: CGI-138; HSPC329; MRP-S23; 28S ribosomal protein S23, mitochondrial; S23mt; mitochondrial ribosomal protein S23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcagccggctggaaaccgtagggagcatcttctctcggactcgggacctggttcgggccggggtgctgaaggagaagcccctgtggtttgacgtatatgacgcctttcccccgctgagggagcccgtcttccaaaggcctcgagtgcgatatggcaaagccaaagctcccatccaagacatctggtaccacgaggatcggattagagcgaagttttattcagtgtatgggtctggtcaaagagcttttgatctattcaatccaaacttcaagtctacctgtcaacggtttgtggagaagtacactgagctacagaaacttggagaaacagatgaagagaagttatttgtggaaacagggaaggctttattggcagaaggtgtcattttaagacgagtaggcgaagcaaggactcaacacggaggtagtcacgtttcccggaaatccgaacacttgagtgtcagaccacagactgcgttggaagaaaacgagactcagaaagaagttccacaggaccagcatttggaggcacctgcagaccagtcgaaaggtctcttgcctccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - torsin family 1, member A (torsin A)
- mitochondrial ribosomal protein L12
- chromosome 1 open reading frame 50
- chromosome 4 open reading frame 43

Reviews

Buy MRPS23-mitochondrial ribosomal protein S23 Gene now

Add to cart