Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene
PTXBC005143
New product
Data sheet of ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005143 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARL6IP5 |
| Origin species: | Human |
| Product name: | ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC005143 |
| Gene id: | 10550 |
| Gene description: | ADP-ribosylation-like factor 6 interacting protein 5 |
| Synonyms: | DERP11; GTRAP3-18; HSPC127; JWA; PRAF3; Yip6b; addicsin; hp22; jmx; PRA1 family protein 3; ADP-ribosylation factor GTPase 6 interacting protein 5; ADP-ribosylation factor-like 6 interacting protein 5; ADP-ribosylation factor-like protein 6-interacting protein 5; ADP-ribosylation-like factor 6 interacting protein 5; ARL-6-interacting protein 5; JM5; PRA1 domain family 3; aip-5; cytoskeleton-related vitamin A-responsive protein; dermal papilla derived protein 11; glutamate transporter EAAC1-interacting protein; glutamate transporter EEAC1-associated protein; prenylated Rab acceptor protein 2; protein JWa; ADP ribosylation factor like GTPase 6 interacting protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgttaatatcgccccactccgcgcctgggacgatttcttcccgggttccgatcgctttgcccggccggacttcagggacatttccaaatggaacaaccgcgtagtgagcaacctgctctattaccagaccaactacctggtggtggctgccatgatgatttccattgtggggtttctgagtcccttcaacatgatcctgggaggaatcgtggtggtgctggtgttcacagggtttgtgtgggcagcccacaataaagacgtccttcgccggatgaagaagcgctaccccacgacgttcgttatggtggtcatgttggcgagctatttccttatctccatgtttggaggagtcatggtctttgtgtttggcattacttttcctttgctgttgatgtttatccatgcatcgttgagacttcggaacctcaagaacaaactggagaataaaatggaaggaataggtttgaagaggacaccgatgggcattgtcctggatgccctagaacagcaggaagaaggcatcaacagactcactgactatatcagcaaagtgaaggaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation-like factor 6 interacting protein 4 - THAP domain containing, apoptosis associated protein 2 - proteasome (prosome, macropain) subunit, alpha type, 3 - proteasome (prosome, macropain) subunit, alpha type, 4 |