Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene
PTXBC011554
New product
Data sheet of N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011554 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | N6AMT1 |
| Origin species: | Human |
| Product name: | N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene |
| Size: | 2ug |
| Accessions: | BC011554 |
| Gene id: | 29104 |
| Gene description: | N-6 adenine-specific DNA methyltransferase 1 (putative) |
| Synonyms: | C21orf127; HEMK2; MTQ2; N6AMT; PRED28; m.HsaHemK2P; hemK methyltransferase family member 2; N6-DNA-methyltransferase; n(6)-adenine-specific DNA methyltransferase 1; N-6 adenine-specific DNA methyltransferase 1 (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggggagaacttcgctacgccgttccacgggcacgtgggccgcggcgccttcagcgacgtgtacgagcccgcggaggacacgtttctgcttttggacgcgctcgaggcagcggctgccgaactggcaggagtggaaatatgcctggaagtagggtcagggtctggtgtagtatctgcattcctagcctctatgataggccctcaggctttgtacatgtgcactgatatcaaccctgaggcagcagcttgtaccctagagacagcacgctgtaacaaagttcacattcaaccagttattacagatttggtaggaagtcacggaatagaggcagcttgggctggtggcagaaatggtcgggaagtcatggacaggttttttcccctggttccagatctcctttcaccaagaggattattctatttagttaccattaaagaaaacaacccagaagaaattttgaaaataatgaagacaaaaggtctgcaaggaaccactgcactttccagacaagcaggccaagaaactctttcagtcctcaagttcaccaagtcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 8 - coiled-coil-helix-coiled-coil-helix domain containing 6 - major histocompatibility complex, class II, DP beta 1 - major histocompatibility complex, class II, DP beta 1 |