PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

View larger

PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

Reference: PTXBC014298

Condition: New product

Print

Data sheet of PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC014298
Product type:	DNA & cDNA
Ncbi symbol:	PRKRIP1
Origin species:	Human
Product name:	PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene
Size:	2ug
Accessions:	BC014298
Gene id:	79706
Gene description:	PRKR interacting protein 1 (IL11 inducible)
Synonyms:	C114; KRBOX3; PRKR-interacting protein 1; KRAB box domain containing 3; likely ortholog of mouse C114 dsRNA-binding protein; PRKR interacting protein 1 (IL11 inducible)
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggctagcccagccgcctcctcggtgcgaccaccgaggcccaagaaagagccgcagacgctcgtcatccccaagaatgcggcggaggagcagaagctcaagctggagcggctcatgaagaacccggacaaagcagttccaattccagagaaaatgagtgaatgggcacctcgacctcccccagaatttgtccgagatgtcatgggttcaagtgctggggccggcagtggagagttccacgtgtacagacatctgcgccggagagaatatcagcgacaggactacatggatgccatggctgagaagcaaaaattgtatgcagagtttcagaaaagactggaaaagaataaaattgctgcagaggagcagaccgcaaagcgccggaagaagcgccagaagttaaaagagaagaaattactggcaaagaagatgaaacttgaacagaagaaacaagaaggacccggtcagcccaaggagcaggggtccagcagctctgcggaggcatctggaacagaggaggaggaggaagtgcccagtttcaccatggggcgatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- glucosamine-phosphate N-acetyltransferase 1 - gem (nuclear organelle) associated protein 8 - insulin-like growth factor binding protein 4 - far upstream element (FUSE) binding protein 3

Reviews

Be the first to write your review !

Buy PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene now