Cart 6 Product Products 697,57 € (empty)
-
1 x BEX2-brain...113,40 € -
1 x CACNG2-cal...121,50 € -
1 x PNLIPRP1-p...113,40 € -
1 x PTER-phosp...121,50 € -
1 x LSDP5-lipi...121,50 € -
No products
To be determined Shipping
697,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 697,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 697,57 €
Data sheet of MRPL18-mitochondrial ribosomal protein L18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL18-mitochondrial ribosomal protein L18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001623 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL18 |
| Origin species: | Human |
| Product name: | MRPL18-mitochondrial ribosomal protein L18 Gene |
| Size: | 2ug |
| Accessions: | BC001623 |
| Gene id: | 29074 |
| Gene description: | mitochondrial ribosomal protein L18 |
| Synonyms: | HSPC071; L18mt; MRP-L18; 39S ribosomal protein L18, mitochondrial; mitochondrial ribosomal protein L18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcttcggtcgcggttttgggggttgttctcggtttgcaggaaccctgggtgcaggttcgcagccctgtcaaccagctccgagccggcagcgaaacctgaagtggaccctgtggaaaatgaagctgtcgccccagaattcaccaaccggaacccccggaacctggagcttttatctgtagccaggaaagagcggggctggcggacggtgtttccctcccgtgagttctggcacaggttgcgagttataaggactcagcatcatgtagaagcacttgtggagcatcagaatggcaaggttgtggtttcggcctccactcgtgagtgggctattaaaaagcacctttatagtaccagaaatgtggtggcttgtgagagtataggacgagtgctggcacagagatgcttagaggcgggaatcaacttcatggtctaccaaccaaccccgtgggaggcagcctcagactcgatgaaacgactacaaagtgccatgacagaaggtggtgtggttctacgggaacctcagagaatctatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAP2B, member of RAS oncogene family - RAP1A, member of RAS oncogene family - mitochondrial ribosomal protein S23 - torsin family 1, member A (torsin A) |