Cart 2 Product Products 230,97 € (empty)
-
1 x TECTB-tect...121,50 € -
No products
To be determined Shipping
230,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 230,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 230,97 €
Data sheet of RPL11-ribosomal protein L11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL11-ribosomal protein L11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018970 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL11 |
| Origin species: | Human |
| Product name: | RPL11-ribosomal protein L11 Gene |
| Size: | 2ug |
| Accessions: | BC018970 |
| Gene id: | 6135 |
| Gene description: | ribosomal protein L11 |
| Synonyms: | DBA7; GIG34; L11; 60S ribosomal protein L11; CLL-associated antigen KW-12; cell growth-inhibiting protein 34; ribosomal protein L11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatcaaggtgaaaaggagaaccccatgcgggaacttcgcatccgcaaactctgtctcaacatctgtgttggggagagtggagacagactgacgcgagcagccaaggtgttggagcagctcacagggcagacccctgtgttttccaaagctagatacactgtcagatcctttggcatccggagaaatgaaaagattgctgtccactgcacagttcgaggggccaaggcagaagaaatcttggagaagggtctaaaggtgcgggagtatgagttaagaaaaaacaacttctcagatactggaaactttggttttgggatccaggaacacatcgatctgggtatcaaatatgacccaagcattggtatctacggcctggacttctatgtggtgctgggtaggccaggtttcagcatcgcagacaagaagcgcaggacaggctgcattggggccaaacacagaatcagcaaagaggaggccatgcgctggttccagcagaagtatgatgggatcatccttcctggcaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L17 - histone deacetylase 7 - CHMP family, member 7 - exostoses (multiple) 1 |